Previous Contig 001699:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019A17Sequence466001699 (4)gb:AY294330_15957996e-62Lycopersicon esculentum MADS-box protein 5 mRNA, complete cds.118010039 (4)
JMFF022B10Sequence511001699 (4)gb:AY294330_15957995e-70Lycopersicon esculentum MADS-box protein 5 mRNA, complete cds.131010039 (4)
JMFF039J03Sequence484001699 (4)gb:AY294330_15957995e-52Lycopersicon esculentum MADS-box protein 5 mRNA, complete cds.146010039 (4)
JMFF039K15Sequence562001699 (4)gb:AY294330_15957991e-66Lycopersicon esculentum MADS-box protein 5 mRNA, complete cds.148010039 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF022B10+ ATTGAGTCCTTGTTGATCTGATCTGCTTCAATGACATAT
JMFF039K15+ CTGATCTGCTTCAATGACATAT
                      ____________________________________________________________
consensus ATTGAGTCCTTGTTGATCTGATCTGCTTCAATGACATAT
 
. : . : . : . : . : . :
JMFF022B10+ CAAGCTGCCTCTCAAGAGATTCAAGTTCCTTGCTGTTTAATGGGCCAAGATCTTCACCTA
JMFF019A17+ GCCTCTCAAGAGATTCAAGTTCCTTGCTGTTTAATGGGCCAAGATCTTCACCTA
JMFF039K15+ CAAGCTGCCTCTCAAGAGATTCAAGTTCCTTGCTGTTTAATGGGCCAAGATCTTCACCTA
JMFF039J03+ CCTA
                      ____________________________________________________________
consensus CAAGCTGCCTCTCAAGAGATTCAAGTTCCTTGCTGTTTAATGGGCCAAGATCTTCACCTA
 
. : . : . : . : . : . :
JMFF022B10+ AAAGATTCCTTTGTGATCTCTGTAGTGCTTCATATCTAGCTTTCAGTTTCAGATACTCCT
JMFF019A17+ AAAGATTCCTTTGTGATCTCTGTAGTGCTTCATATCTAGCTTTCAGTTTCAGATACTCCT
JMFF039K15+ AAAGATTCCTTTGTGATCTCTGTAGTGCTTCATATCTAGCTTTCAGTTTCAGATACTCCT
JMFF039J03+ AAAGATTCCTTTGTGATCTCTGTAGTGCTTCATATCTAGCTTTCAGTTTCAGATACTCCT
                      ____________________________________________________________
consensus AAAGATTCCTTTGTGATCTCTGTAGTGCTTCATATCTAGCTTTCAGTTTCAGATACTCCT
 
. : . : . : . : . : . :
JMFF022B10+ GCTGACTACTTATCTCCTGCAGTGCCTCCCTTGTGGATATATTGGGCTCTGGTGCTCCAT
JMFF019A17+ GCTGACTACTTATCTCCTGCAGTGCCTCCCTTGTGGATATATTGGGCTCTGGTGCTCCAT
JMFF039K15+ GCTGACTACTTATCTCCTGCAGTGCCTCCCTTGTGGATATATTGGGCTCTGGTGCTCCAT
JMFF039J03+ GCTGACTACTTATCTCCTGCAGTGCCTCCCTTGTGGATATATTGGGCTCTGGTGCTCCAT
                      ____________________________________________________________
consensus GCTGACTACTTATCTCCTGCAGTGCCTCCCTTGTGGATATATTGGGCTCTGGTGCTCCAT
 
. : . : . : . : . : . :
JMFF022B10+ AGTTGCATTTCTGATACCTCTCCAGTGTCTTGAGCATGCTAGAGCTACTGCAGAACTCAT
JMFF019A17+ AGTTGCATTTCTGATACCTCTCCAGTGTCTTGAGCATGCTAGAGCTACTGCAGAACTCAT
JMFF039K15+ AGTTGCATTTCTGATACCTCTCCAGTGTCTTGAGCATGCTAGAGCTACTGCAGAACTCAT
JMFF039J03+ AGTTGCATTTCTGATACCTCTCCAGTGTCTTGAGCATGCTAGAGCTACTGCAGAACTCAT
                      ____________________________________________________________
consensus AGTTGCATTTCTGATACCTCTCCAGTGTCTTGAGCATGCTAGAGCTACTGCAGAACTCAT
 
. : . : . : . : . : . :
JMFF022B10+ AGAGCTTTCCCCTGTTGGAGAAAATGATGAGAGCAACCTCAGCATCACAAAGAACAGAGA
JMFF019A17+ AGAGCTTTCCCCTGTTGGAGAAAATGATGAGAGCAACCTCAGCATCACAAAGAACAGAGA
JMFF039K15+ AGAGCTTTCCCCTGTTGGAGAAAATGATGAGAGCAACCTCAGCATCACAAAGAACAGAGA
JMFF039J03+ AGAGCTTTCCCCTGTTGGAGAAAATGATGAGAGCAACCTCAGCATCACAAAGAACAGAGA
                      ____________________________________________________________
consensus AGAGCTTTCCCCTGTTGGAGAAAATGATGAGAGCAACCTCAGCATCACAAAGAACAGAGA
 
. : . : . : . : . : . :
JMFF022B10+ GCTCATATGCTTTTTTCAGAAGCCCATTTCTTCGCTTTGCAAAGGTTACTTGTCTGTTGA
JMFF019A17+ GCTCATATGCTTTTTTCAGAAGCCCATTTCTTCGCTTTGCAAAGGTTACTTGTCTGTTGA
JMFF039K15+ GCTCATATGCTTTTTTCAGAAGCCCATTTCTTCGCTTTGCAAAGGTTACTTGTCTGTTGA
JMFF039J03+ GCTCATATGCTTTTTTCAGAAGCCCATTTCTTCGCTTTGCAAAGGTTACTTGTCTGTTGA
                      ____________________________________________________________
consensus GCTCATATGCTTTTTTCAGAAGCCCATTTCTTCGCTTTGCAAAGGTTACTTGTCTGTTGA
 
. : . : . : . : . : . :
JMFF022B10+ TTTTGTTCTCAATTCTCTTCAGTTCAACCCTACCTCTCCCCATCCTCTCTCTCTCTCTCT
JMFF019A17+ TTTTGTTCTCAATTCTCTTCAGTTCAACCCTACCTCTCCCCATCCTCTCTCTCTCTCTCT
JMFF039K15+ TTTTGTTCTCAATTCTCTTCAGTTCAACCCTACCTCTCCCCATCCTCTCTCTCTCTCTCT
JMFF039J03+ TTTTGTTCTCAATTCTCTTCAGTTCAACCCTACCTCTCCCCATCCTCTCTCTCTCTCTCT
                      ____________________________________________________________
consensus TTTTGTTCTCAATTCTCTTCAGTTCAACCCTACCTCTCCCCATCCTCTCTCTCTCTCTCT
 
. : . : . : . : . : . :
JMFF022B10+ CTCTCTCTTTCTCTCTCTCTACTAGCAACCTCTGAAACTCACAAAAGCACAC
JMFF019A17+ CTCTCTCTTTCTCTCTCTCTACTAGCAACCTCTGAAACTCACAAAAGCACAC
JMFF039K15+ CTCTCTCTTTCTCTCTCTCTACTAGCAACCTCTGAAACTCACAAAAGCACACAATCCCTT
JMFF039J03+ CTCTCTCTTTCTCTCTCTCTACTAGCAACCTCTGAAACTCACAAAAGCACACAATCCCTT
                      ____________________________________________________________
consensus CTCTCTCTTTCTCTCTCTCTACTAGCAACCTCTGAAACTCACAAAAGCACACAATCCCTT
 
. : . : . : . : . : . :
JMFF039K15+ TTTCCCTTTCAAAACTTTTCTTTGTATATCACTTCTCTTATATCTAGCTAAGATATACAC
JMFF039J03+ TTTCCCTTTCAAAACTTTTCTTTGTATATCACTTCTCTTATATCTAGCTAAGATATACAC
                      ____________________________________________________________
consensus TTTCCCTTTCAAAACTTTTCTTTGTATATCACTTCTCTTATATCTAGCTAAGATATACAC