Previous Contig 001689:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002A08Sequence600001689 (59)gb:AF283476_17830467e-99Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF002M13Sequence609001689 (59)gb:AF283476_17830465e-96Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.724001689 (59)gb:AF283476_17830466e-83Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF005G24Sequence470001689 (59)gb:AF283476_17830462e-67Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.717001689 (59)gb:AF283476_17830466e-83Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF007I23Sequence597001689 (59)gb:AF283476_1783046e-101Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.766001689 (59)gb:AF283476_1783046e-107Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF008B15Sequence554001689 (59)gb:AF283476_17830462e-89Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.762001689 (59)gb:AF283476_1783046e-108Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF008F10Sequence572001689 (59)gb:AF283476_17830461e-93Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.793001689 (59)gb:AF283476_1783046e-118Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF009K05Sequence571001689 (59)gb:AF283476_17830466e-92Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.800001689 (59)gb:AF283476_1783046e-119Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF011N04Sequence574001689 (59)gb:AF283476_17830461e-93Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.757001689 (59)gb:AF283476_1783046e-110Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF012J21Sequence558001689 (59)gb:AF283476_17830466e-91Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.769001689 (59)gb:AF283476_1783046e-110Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF020D16Sequence553001689 (59)gb:AF283476_17830461e-84Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.747001689 (59)gb:AF283476_1783046e-103Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF021H22Sequence617001689 (59)gb:AF283476_17830462e-59Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF022D18Sequence503001689 (59)gb:AF283476_17830463e-79Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.769001689 (59)gb:AF283476_1783046e-102Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF024I13Sequence375001689 (59)gb:AF283476_17830467e-50Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.729001689 (59)gb:AF283476_1783046e-104Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF026H14Sequence552001689 (59)gb:AF283476_17830467e-90Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.745001689 (59)gb:AF283476_1783046e-108Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF027O06Sequence502001689 (59)gb:AF283476_17830468e-80Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.749001689 (59)gb:AF283476_1783046e-108Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF030B11Sequence564001689 (59)gb:AF283476_17830461e-86Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.725001689 (59)gb:AF283476_17830461e-86Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF033K09Sequence553001689 (59)gb:AF283476_17830466e-91Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.755001689 (59)gb:AF283476_17830461e-88Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF033K10Sequence212001689 (59)gb:AF283476_17830464e-21Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.607001689 (59)gb:AF283476_17830465e-74Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF034F19Sequence603001689 (59)gb:AF283476_1783046e-100Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.738001689 (59)gb:AF283476_17830465e-96Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF039F11Sequence561001689 (59)gb:AF283476_17830461e-91Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.572001689 (59)gb:AF283476_17830463e-66Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF041J11Sequence644001689 (59)gb:AF283476_1783046e-111Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF042A07Sequence628001689 (59)gb:AF283476_1783046e-106Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.526001689 (59)gb:AF283476_17830461e-54Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF049L11Sequence642001689 (59)gb:AF283476_1783046e-110Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.570001689 (59)gb:AF283476_17830463e-41Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFF050A15Sequence643001689 (59)gb:AF283476_1783046e-109Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.628001689 (59)gb:AF283476_17830463e-69Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFN009L15Sequence619001689 (59)gb:AF283476_1783046e-121Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFN028O16Sequence663001689 (59)gb:AF283476_1783046e-125Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFN035G06Sequence492001689 (59)gb:AF283476_17830467e-52Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFN036P12Sequence524001689 (59)gb:AF283476_17830466e-88Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFS048D05Sequence426001689 (59)gb:AF283476_17830461e-59Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMFS126F02Sequence573001689 (59)gb:AF283476_17830463e-98Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMSF028C16Sequence675001689 (59)gb:AF283476_1783046e-117Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.774001689 (59)gb:AF283476_17830466e-88Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMSF029C16Sequence646001689 (59)gb:AF283476_1783046e-111Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.565001689 (59)gb:AF101239_17681492e-50Ipomoea batatas cathepsin B-like cysteine proteinase (CathB) mRNA, complete cds.
JMSF033L14Sequence715001689 (59)gb:AF283476_1783046e-124Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.730001689 (59)gb:AF283476_1783046e-110Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.
JMSF042K12Sequence759001689 (59)gb:AF283476_1783046e-132Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.811001689 (59)gb:AF283476_1783046e-117Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049L11- CCACTAAAGAAATCATGTATAACAAACTTAATTAAGAAGATATTACTAGAATT
rJMFF002M13- TT
rJMSF028C16- GAAGATATTACTAGAATT
rJMFF033K09- TT
                      ____________________________________________________________
consensus CCACTAAAGAAATCATGTATAACAAACTTAATTAAGAAGATATTACTAGAATT
 
. : . : . : . : . : . :
rJMFF049L11- GAACTCGGGACAGTTACAAAGAACAACATTGACCAGAGACAGAAGATCATGCATGATACA
rJMFF002M13- GAACTCGGGACAGTTACAAAGAACAACATTGACCAGAGACAGAAGATCATGCATAATACA
rJMSF028C16- GAACTCGGGACAGTTACAAAGAACAACATTGACCAGAGACAGAAGATCATGCATGATACA
rJMFF030B11- AAAGAACAACATTGACCAGAGACAGAAGATCATGCATGATACA
rJMFF005G24- AGTTACAAAGAACAACATTGACCAGAGACAGAAGATCATGCATGATACA
rJMFF021H22- AGTTACAAAGAACAACATTGACCAGAGACAGAAGATCATGCATGATACA
rJMFF033K09- GAACTCGGGACAGTTACAAAGAACAACATTGACCAGAGACAGAAGATCATGCATGATACA
rJMFF022D18- AAGATCATGCATGATACA
                      ____________________________________________________________
consensus GAACTCGGGACAGTTACAAAGAACAACATTGACCAGAGACAGAAGATCATGCATGATACA
 
. : . : . : . : . : . :
rJMFF049L11- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF033K10- TAAACCTTGGGCTTNAATAAACTTGAAAGGTTACAA
rJMFF050A15- TAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
JMFN035G06+ AACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMSF029C16- ACAAACAAGATTCATAACACTAANCCTTGGGCNTCAATAAACTTGAAAGGTTACAA
rJMFF042A07- AACACTAAACCTGGGGCTTAAATAAACTGGAAGGGTTACAA
rJMFF002M13- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMSF028C16- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF030B11- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF005G24- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF021H22- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF033K09- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF022D18- AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF008B15- AGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF007I23- AGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF027O06- AACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF034F19- AAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF012J21- TAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMSF042K12- AGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
rJMFF011N04- GGGCTTC-ATAAACTTGAAAGGTTACAA
rJMFF026H14- TTGGGCTTC-ATAAACTTGAAAGGTTACAA
rJMFF020D16- TTGGGCTTC-ATAAACTTGAAAGGTTACAA
rJMSF033L14- A
rJMFF024I13- GGGCTTC-ATAAACTTGAAAGGTTACAA
rJMFF039F11- TTGGGCTTC-ATAAACTTGAAAGGTTACAA
rJMFF008F10- CTTGGGCTTC-ATAAACTTGAAAGGTTACAA
rJMFF009K05- GGGCTTC-ATAAACTTGAAAGGTTACAA
                      ____________________________________________________________
consensus AATTACAAACAAGATTCATAACACTAAACCTTGGGCTTCAATAAACTTGAAAGGTTACAA
 
. : . : . : . : . : . :
rJMFF049L11- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF033K10- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF050A15- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
JMFN035G06+ AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMSF029C16- AGTTCTTTAACTTACACAAGATGANTAGAAACAGAGCCATGTCTATATGTNTATTACCCT
rJMFF042A07- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCG
rJMFF002M13- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMSF028C16- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF030B11- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF005G24- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF021H22- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF033K09- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF022D18- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF008B15- AGTTCTTTAACTTACACGAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF007I23- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF027O06- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF034F19- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF012J21- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMSF042K12- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF011N04- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGCTTATTACCCT
rJMFF026H14- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF020D16- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMSF033L14- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF024I13- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF039F11- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF008F10- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
rJMFF009K05- AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
                      ____________________________________________________________
consensus AGTTCTTTAACTTACACAAGATGACTAGAAACAGAGCCATGTCTATATGTTTATTACCCT
 
. : . : . : . : . : . :
rJMFF049L11- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF033K10- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF050A15- GGAGAAATATTTTACAACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
JMFN035G06+ GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMSF029C16- GGAGAAATATTTTAC-ACTGCAGCNATGAAATATGGAGGGATAACAGCATTCNNACNGAG
rJMFF042A07- GGAAAAATATTTTAC-ACTGCAGCTATGAAATATGGGGGGATAACAGCATTCAAACTGGG
rJMFF002M13- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMSF028C16- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF030B11- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF005G24- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF021H22- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF033K09- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF022D18- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF008B15- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF007I23- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF027O06- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF034F19- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF012J21- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMSF042K12- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF011N04- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF026H14- GGAGAAATATTTTACAACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF020D16- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMSF033L14- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF024I13- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF039F11- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF008F10- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
rJMFF009K05- GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
                      ____________________________________________________________
consensus GGAGAAATATTTTAC-ACTGCAGCTATGAAATATGGAGGGATAACAGCATTCAAACTGAG
 
. : . : . : . : . : . :
rJMFF049L11- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF033K10- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF050A15- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
JMFN035G06+ GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMSF029C16- GCNACAAGAGNATCATCNTCCCTTACACCAGATTTAATATCCNAGTTCCTTGTTGATGGN
rJMFF042A07- GCAACAAGAGAATCATCATCCTTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF002M13- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMSF028C16- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF030B11- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF005G24- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF021H22- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF033K09- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF022D18- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF008B15- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF007I23- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF027O06- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF034F19- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF012J21- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMSF042K12- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF011N04- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF026H14- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF020D16- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMSF033L14- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF024I13- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF039F11- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF008F10- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
rJMFF009K05- GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
                      ____________________________________________________________
consensus GCAACAAGAGAATCATCATCCCTTACACCAGATTTAATATCCAAGTTCCTTGTTGATGGC
 
. : . : . : . : . : . :
rJMFF049L11- ATTCCTGCAGTTACATCTTCTTCAATCCCGAACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF033K10- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF050A15- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
JMFN035G06+ ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMSF029C16- ATTCCTGCNNTTNCATCNTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATNTGGAAG
rJMFF042A07- ATTCCTGCAGTTACATTTTTTTAAATCCCGCACTCATTTGTTCCTGGGACGATCTGGAAG
rJMFF002M13- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMSF028C16- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF030B11- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF005G24- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF021H22- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF033K09- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF022D18- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF008B15- ATTCCCGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF007I23- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF027O06- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF034F19- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF012J21- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMSF042K12- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF011N04- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF026H14- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF020D16- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMSF033L14- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF024I13- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF039F11- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF008F10- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
rJMFF009K05- ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
JMFN009L15+ TGGAAG
                      ____________________________________________________________
consensus ATTCCTGCAGTTACATCTTCTTCAATCCCGCACTCATTTGTTCCTCGGACGATCTGGAAG
 
. : . : . : . : . : . :
rJMFF049L11- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF033K10- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF050A15- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
JMFN035G06+ TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMSF029C16- TACCCNTCNTCGCCCCAGCTTCTGTTCCACTGATTANCGAGGAGCCAATAGTCTTCTCCA
rJMFF042A07- TACCCATCATCGCCCCAGTTTTTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF002M13- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMSF028C16- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF030B11- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF005G24- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF021H22- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF033K09- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF022D18- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF008B15- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF007I23- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF027O06- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF034F19- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF012J21- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMSF042K12- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF011N04- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF026H14- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF020D16- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMSF033L14- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF024I13- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF039F11- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF008F10- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
rJMFF009K05- TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
JMFN009L15+ TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
                      ____________________________________________________________
consensus TACCCATCATCGCCCCAGCTTCTGTTCCACTGATTAGCGAGGAGCCAATAGTCTTCTCCA
 
. : . : . : . : . : . :
rJMFF049L11- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF033K10- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF050A15- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
JMFN035G06+ TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMSF029C16- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF042A07- TCCTAAAAAGTTCCCCATCCTATGAGCTTAACAGGGGGTCCTCCCATTACACCGCCTGTG
rJMFF002M13- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMSF028C16- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF030B11- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF005G24- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF021H22- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF033K09- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF022D18- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF008B15- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF007I23- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGCGTCCTCCCATTACACCGCCTGTG
rJMFF027O06- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF034F19- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF012J21- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMSF042K12- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF011N04- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF026H14- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF020D16- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMSF033L14- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF024I13- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF039F11- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF008F10- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
rJMFF009K05- TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
JMFN009L15+ TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
JMFN028O16+ AGTTCCCCATCNTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
                      ____________________________________________________________
consensus TCCTCAGAAGTTCCCCATCCTATGAGCTTAACAGCGTGTCCTCCCATTACACCGCCTGTG
 
. : . : . : . : . : . :
rJMFF049L11- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATC
rJMFF033K10- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF050A15- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
JMFN035G06+ ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMSF029C16- ACGTGCTTGTAGACTCCCGATTTGTAATGTGCANGNATCCTCGTAGACAGTAAAGGAGAC
rJMFF042A07- ACATGCTTGTAAACTCCCGATTTGTAATGGGCA-AAATCCTCGTAAACAGTAAAGGAGAC
rJMFF002M13- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMSF028C16- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF030B11- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF005G24- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF021H22- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF033K09- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF022D18- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF008B15- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF007I23- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF027O06- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF034F19- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF012J21- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMSF042K12- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF011N04- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF026H14- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF020D16- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMSF033L14- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF024I13- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF039F11- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF008F10- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
rJMFF009K05- ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
JMFN009L15+ ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
JMFN028O16+ ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
                      ____________________________________________________________
consensus ACATGCTTGTAGACTCCCGATTTGTAATGTGCA-AAATCCTCGTAGACAGTAAAGGAGAC
 
. : . : . : . : . : . :
rJMFF033K10- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGNTGATCANAGCTCACTCG
rJMFF050A15- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
JMFN035G06+ CTCAACGGGGCCATTTTTATAAACTTCTGCCAT
rJMSF029C16- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGANCANAGCTCACTCG
rJMFF042A07- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGGGTTGATCAGAGCTCACTCG
rJMFF002M13- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMSF028C16- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF030B11- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF005G24- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF021H22- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCANAGCTCACTCG
rJMFF033K09- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF022D18- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF008B15- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF007I23- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF027O06- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF034F19- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF012J21- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMSF042K12- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF011N04- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF026H14- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF020D16- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMSF033L14- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF024I13- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF039F11- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCANAGCTCACTCG
rJMFF008F10- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
rJMFF009K05- CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
JMFN009L15+ CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
JMFN028O16+ CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
JMSF033L14+ G
JMSF042K12+ TTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
                      ____________________________________________________________
consensus CTCAACGGGGCCATTTTTATAAACTTCTGCCATGATGCTGTGTTGATCAGAGCTCACTCG
 
. : . : . : . : . : . :
rJMFF033K10- GTATGCATTAACGCTAAAATGNTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF050A15- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMSF029C16- GNATGCATTAACGCTAANATGTTTGGATTC
rJMFF042A07- GTATGCA
rJMFF002M13- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMSF028C16- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF030B11- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF005G24- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF021H22- GTATGCATTAACGCTAAA
rJMFF033K09- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF022D18- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF008B15- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF007I23- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF027O06- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF034F19- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF012J21- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMSF042K12- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF011N04- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF026H14- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF020D16- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMSF033L14- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF024I13- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF039F11- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCCTTTTACACATT
rJMFF008F10- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
rJMFF009K05- GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
JMFN009L15+ GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
JMFN028O16+ GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
JMSF028C16+ AAAGCAGATTCTCC-TTTACACATT
JMSF033L14+ GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
JMSF042K12+ GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
                      ____________________________________________________________
consensus GTATGCATTAACGCTAAAATGTTTGGATTCCGACCAAAGCAGATTCTCC-TTTACACATT
 
. : . : . : . : . : . :
rJMFF033K10- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTC
rJMFF050A15- TCTTC
rJMFF002M13- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMSF028C16- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF030B11- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGNTT
rJMFF005G24- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF033K09- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF022D18- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF008B15- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF007I23- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF027O06- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF034F19- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF012J21- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMSF042K12- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF011N04- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF026H14- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF020D16- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMSF033L14- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF024I13- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF039F11- TCT
rJMFF008F10- TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
rJMFF009K05- TCTTCTCGCATGCAGGAGTGGTATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMFN009L15+ TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMFN028O16+ TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMSF029C16+ TCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMFF049L11+ CATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMFF007I23+ GGCACATCCGGTTT
JMFS126F02+ CGGTTT
JMFF041J11+ CGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMSF028C16+ TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMSF033L14+ TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMFF050A15+ GCAGGAGTGGGATATGATGGCTCACAACCGGNATGGGCACATCCGGTTT
JMFF042A07+ GATGGCTCACAACCGGGATGGGCACATCCGGTTT
JMFF034F19+ ATCCGGTTT
JMFF002M13+ TGGGCACATCCGGTTT
JMSF042K12+ TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
                      ____________________________________________________________
consensus TCTTCTCGCATGCAGGAGTGGGATATGATGGCTCACAACCGGGATGGGCACATCCGGTTT
 
. : . : . : . : . : . :
rJMFF002M13- GGTC
rJMSF028C16- GGTCAAAGTAAGGGTCGCACTCTGAA
rJMFF030B11- GGTCNAAGTAAGGGTCGCACTCTGA
rJMFF005G24- GGTC
rJMFF033K09- GGTCNAAGTAAGGGTCGCACTCTGAAGTAA-CNACAC
rJMFF022D18- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF008B15- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF007I23- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF027O06- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF034F19- GGTCAAAGTAAGGGTCGCACTCTGAAGTAACCAACACCAGTACGCGTAAAGTATTGCCNA
rJMFF012J21- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMSF042K12- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF011N04- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF026H14- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF020D16- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMSF033L14- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF024I13- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF008F10- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
rJMFF009K05- GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFN009L15+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFN028O16+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMSF029C16+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF049L11+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF007I23+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFS126F02+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF041J11+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMSF028C16+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMSF033L14+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF050A15+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF042A07+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF034F19+ GGTCAAAGTAAGGGTCGCACTNTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF002M13+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF008F10+ TGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF011N04+ TCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF009K05+ GAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF012J21+ CAGTACGCGTAAAGTATTGCCAA
JMFF030B11+ A-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF033K09+ AGTACGCGTAAAGTATTGCCAA
JMFF026H14+ GCGTAAAGTATTGCCAA
JMFF008B15+ ACGCGTAAAGTATTGCCAA
JMFN036P12+ TAAAGTATTGCCAA
JMFS048D05+ AAGTATTGCCAA
JMFF002A08+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF020D16+ GCGTAAAGTATTGCCAA
JMSF042K12+ GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
JMFF039F11+ ACCAGTACGCGTAAAGTATTGCCAA
                      ____________________________________________________________
consensus GGTCAAAGTAAGGGTCGCACTCTGAAGTAA-CAACACCAGTACGCGTAAAGTATTGCCAA
 
. : . : . : . : . : . :
rJMFF022D18- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CC
rJMFF008B15- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGC
rJMFF007I23- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
rJMFF027O06- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
rJMFF034F19- GCTGCTATAGGATAACCGCCATCAC-AACCTTCACCCGCACAT-AAAG
rJMFF012J21- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
rJMSF042K12- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CNGCACAT-AAAGCCACAGCACGCT
rJMFF011N04- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
rJMFF026H14- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
rJMFF020D16- GCTGCTATANGATAACCGCCATCAC-AACCTTCA-CCGCACATAAAAGCCACAGCACGCT
rJMSF033L14- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
rJMFF024I13- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGC
rJMFF008F10- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
rJMFF009K05- GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFN009L15+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFN028O16+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMSF029C16+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF049L11+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF007I23+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFS126F02+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF041J11+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMSF028C16+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMSF033L14+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF050A15+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF042A07+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF034F19+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF002M13+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGNT
JMFF008F10+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF011N04+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF009K05+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF012J21+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF030B11+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF033K09+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF026H14+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF008B15+ GCTGCTATAGGATAACCGCCATCAC-AACNTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFN036P12+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF022D18+ A-CCGCACAT-AAAGCCACAGCACGCT
JMFF027O06+ TTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFS048D05+ GCTGCTATAGGATATCCGCCATCTC-AACTTTCA-CCGCACAT-AAAGCCACAGCACGTT
JMFF002A08+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF020D16+ GCTGCTATAGGATAACCGCCATCACAAACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMSF042K12+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
JMFF039F11+ GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
                      ____________________________________________________________
consensus GCTGCTATAGGATAACCGCCATCAC-AACCTTCA-CCGCACAT-AAAGCCACAGCACGCT
 
. : . : . : . : . : . :
rJMFF007I23- AAGA
rJMFF027O06- AA
rJMFF012J21- AAGAGGTCATTGAC
rJMSF042K12- AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAA
rJMFF011N04- AAGANGTCATTGACAGA
rJMFF026H14- AA
rJMFF020D16- AAGA
rJMSF033L14- AAGAGGTCATTGACA
rJMFF008F10- AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAA
rJMFF009K05- AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFN009L15+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFN028O16+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMSF029C16+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF049L11+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF007I23+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFS126F02+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF041J11+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMSF028C16+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMSF033L14+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF050A15+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF042A07+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF034F19+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF002M13+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF008F10+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF011N04+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF009K05+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF012J21+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF030B11+ -AGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF033K09+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF026H14+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF008B15+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFN036P12+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF022D18+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF027O06+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF005G24+ TTGACAGATAGAGTCACGTTTGTCCCCATAATGAATGCAAAACCGGTCAGT
JMFS048D05+ AAGAGGTCATNGACAGAAAGAGTCACGTTGTT-CCCATAATGAATGCAAAACTGGTCAGT
JMFF002A08+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF020D16+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMSF042K12+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
JMFF039F11+ AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
                      ____________________________________________________________
consensus AAGAGGTCATTGACAGATAGAGTCACGTTTGT-CCCATAATGAATGCAAAACCGGTCAGT
 
. : . : . : . : . : . :
rJMFF009K05- T
JMFN009L15+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFN028O16+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMSF029C16+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF049L11+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF007I23+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFS126F02+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF041J11+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMSF028C16+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMSF033L14+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF050A15+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF042A07+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF034F19+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF002M13+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF008F10+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF011N04+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF009K05+ TAATGACTCAACTGCACCAAACGCCCAGAGAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF012J21+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF030B11+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF033K09+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF026H14+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF008B15+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFN036P12+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF022D18+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF027O06+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF005G24+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF024I13+ TGATCAAGAATATC
JMFS048D05+ TAATGATTCAAGTGCACCAAACGCCCAGCAAGATCCGCAGTGTCCTTGATCAAGAAGATC
JMFF002A08+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF020D16+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMSF042K12+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
JMFF039F11+ TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
                      ____________________________________________________________
consensus TAATGACTCAACTGCACCAAACGCCCAGCAAGAACCGCAGTGTCCCTGATCAAGAATATC
 
. : . : . : . : . : . :
JMFN009L15+ TGCAATGGAGACACACTGAG
JMFN028O16+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMSF029C16+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF049L11+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF007I23+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFS126F02+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF041J11+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMSF028C16+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMSF033L14+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF050A15+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF042A07+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF034F19+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF002M13+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF008F10+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF011N04+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF009K05+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF012J21+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF030B11+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF033K09+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF026H14+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF008B15+ TGCAATGGAGACACACTGAGGCCAAGCAGTACGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFN036P12+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF022D18+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF027O06+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF005G24+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF024I13+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFS048D05+ TGCAATGGAGACACATNGAGGCCAAGCAGTCCGTGCATCAAAAGATTTGGGAAATTGTAT
JMFF002A08+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF020D16+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMSF042K12+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
JMFF039F11+ TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
                      ____________________________________________________________
consensus TGCAATGGAGACACACTGAGGCCAAGCAGTCCGTGCATCAAAAGTTTTGGGTAATTCTAT
 
. : . : . : . : . : . :
JMFN028O16+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMSF029C16+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF049L11+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF007I23+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTCTAGC
JMFS126F02+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF041J11+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMSF028C16+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMSF033L14+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF050A15+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF042A07+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF034F19+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF002M13+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF008F10+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF011N04+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF009K05+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF012J21+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF030B11+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF033K09+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF026H14+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF008B15+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFN036P12+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF022D18+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF027O06+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF005G24+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF024I13+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFS048D05+ TAGTTTGTCATGTGTAGTTACGGGAGTTCGCTTCAATAGAGACTTGGGNGCCNNTTAAGC
JMFF002A08+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF020D16+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMSF042K12+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
JMFF039F11+ TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
                      ____________________________________________________________
consensus TTGTTTGTCATGTGTAGCTACGGGAGTTCTCTTCAATAGAGACTTGGGTGCCTTTTTAGC
 
. : . : . : . : . : . :
JMFN028O16+ TCCAAGGAGACGCTTAA
JMSF029C16+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF049L11+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF007I23+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFS126F02+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF041J11+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMSF028C16+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMSF033L14+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF050A15+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF042A07+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF034F19+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF002M13+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF008F10+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF011N04+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF009K05+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF012J21+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF030B11+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF033K09+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF026H14+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF008B15+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFN036P12+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF022D18+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF027O06+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF005G24+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF024I13+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFS048D05+ TCCAAGGAGACG
JMFF033K10+ TAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF002A08+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF020D16+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATATCAGC
JMSF042K12+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
JMFF039F11+ TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
                      ____________________________________________________________
consensus TCCAAGGAGACGCTTAAATTGGCTAACAGTGAAGTCTGAGAATCGAGGGTTCATGTCAGC
 
. : . : . : . : . : . :
JMSF029C16+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF049L11+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF007I23+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFS126F02+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF041J11+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMSF028C16+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMSF033L14+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF050A15+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF042A07+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF034F19+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF002M13+ TTTCCATCCTGCTTCCGGATTTTCATTAACAG-TTTAACGATTTCATCCTGAAGGATCTT
JMFF008F10+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF011N04+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF009K05+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF012J21+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF030B11+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF033K09+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF026H14+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF008B15+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFN036P12+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCCCCAGGATCTT
JMFF022D18+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF027O06+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF005G24+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF024I13+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF033K10+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF002A08+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF020D16+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMSF042K12+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
JMFF039F11+ TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
                      ____________________________________________________________
consensus TTTCCATCCTGCTTCCGGATTTTCATTAACAGTTTTAACGATTTCATCCTGAAGGATCTT
 
. : . : . : . : . : . :
JMSF029C16+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF049L11+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF007I23+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFS126F02+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF041J11+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMSF028C16+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMSF033L14+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF050A15+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF042A07+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF034F19+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF002M13+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF008F10+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF011N04+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF009K05+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF012J21+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF030B11+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF033K09+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF026H14+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF008B15+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFN036P12+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF022D18+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF027O06+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF005G24+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF024I13+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF033K10+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF002A08+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF020D16+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMSF042K12+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
JMFF039F11+ TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
                      ____________________________________________________________
consensus TGGGTCAACTTCACTCTGTGTTACTGGCTTCACTGCTACAACCTGCAAGATAAGCAAGGA
 
. : . : . : . : . : . :
JMSF029C16+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTT
JMFF049L11+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTT
JMFF007I23+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTT
JMFS126F02+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCG
JMFF041J11+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTT
JMSF028C16+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTT
JMSF033L14+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGC
JMFF050A15+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF042A07+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF034F19+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF002M13+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF008F10+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF011N04+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTCAGCT
JMFF009K05+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF012J21+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF030B11+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTA
JMFF033K09+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCT
JMFF026H14+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF008B15+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFN036P12+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTC
JMFF022D18+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF027O06+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTT
JMFF005G24+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF024I13+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF033K10+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTNGTTTCT
JMFF002A08+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF020D16+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMSF042K12+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCT
JMFF039F11+ GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCTC
                      ____________________________________________________________
consensus GATGGCTCCGATGAGCAGAAGGGTCTTGATCGTCTCCATTTTTTTCTTGTTTCTTAGCTC