Previous Contig 001683:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035O04Sequence497001683 (5)pir|T04663|T046633e-69hypothetical protein F8D20.90 - Arabidopsis thaliana>gb:ATCHRIV83_1547518 Arabid665010779 (7)gb:AL356504_19246160.028Human DNA sequence from clone RP1-14N1 on chromosome 1q21.1-21.3 Contains part o
JMFF039B08Sequence481001683 (5)pir|T04663|T046631e-54hypothetical protein F8D20.90 - Arabidopsis thaliana>gb:ATCHRIV83_1547518 Arabid442010779 (7)
JMFF047N17Sequence620001683 (5)pir|T04663|T046635e-78hypothetical protein F8D20.90 - Arabidopsis thaliana>gb:ATCHRIV83_1547518 Arabid581010779 (7)
JMSF023A24Sequence597001683 (5)pir|T04663|T046631e-74hypothetical protein F8D20.90 - Arabidopsis thaliana>gb:ATCHRIV83_1547518 Arabid732010779 (7)gb:AL356504_19246160.033Human DNA sequence from clone RP1-14N1 on chromosome 1q21.1-21.3 Contains part o
JMSF032L04Sequence701001683 (5)pir|T04663|T046639e-82hypothetical protein F8D20.90 - Arabidopsis thaliana>gb:ATCHRIV83_1547518 Arabid716010779 (7)gb:AL356504_19246160.032Human DNA sequence from clone RP1-14N1 on chromosome 1q21.1-21.3 Contains part o

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032L04+ AACGGGCAACATAACAATAGAGGTTACATTAGCT
                      ____________________________________________________________
consensus AACGGGCAACATAACAATAGAGGTTACATTAGCT
 
. : . : . : . : . : . :
JMSF032L04+ TTTTGTGGTTGCCTGTCTAGAAGTGCTGCTTCTTGGAAAAGATTTGATGATACATCATCA
                      ____________________________________________________________
consensus TTTTGTGGTTGCCTGTCTAGAAGTGCTGCTTCTTGGAAAAGATTTGATGATACATCATCA
 
. : . : . : . : . : . :
JMSF032L04+ GGAGAGGATTTATTTGTAGCAGGGGATGAGCCACTAGGCTCAGCTTCATCACATTTTCTG
JMSF023A24+ TCTG
JMFF047N17+ TCAGCTTCATCACATTTTCTG
                      ____________________________________________________________
consensus GGAGAGGATTTATTTGTAGCAGGGGATGAGCCACTAGGCTCAGCTTCATCACATTTTCTG
 
. : . : . : . : . : . :
JMSF032L04+ TCATCAGACTTATGGAACAAGTGACAAAGGACAAAAGCTCCCTGGCCAGGGCGAGTGCCA
JMSF023A24+ TCATCAGACTTATGGANCNAGCGACAAAGGACAAAAGCTCCCTGGCCAGGGCGAGTGCCA
JMFF035O04+ AGGGCGAGTGCCA
JMFF047N17+ TCATCAGACTTATGGAACAAGCGACAAAGGACAAAAGCTCCCTGGCCAGGGCGAGTGCCA
                      ____________________________________________________________
consensus TCATCAGACTTATGGAACAAGCGACAAAGGACAAAAGCTCCCTGGCCAGGGCGAGTGCCA
 
. : . : . : . : . : . :
JMSF032L04+ TCAAGGTCTGGTTCAGTGGCACGATATTCATGCATTATCCAATTTGTGCGTTCGCCTTTT
JMSF023A24+ TCAAGGTCTGGTTCAGTGGCACGATANTCATGCATTATCCAATTTGNGCGTTCGCCTTTT
JMFF035O04+ TCAAGGTCTGGTTCAGTGGCACGATATTCATGCATTATCCAATTTGTGCGTTCGCCTTTT
JMFF047N17+ TCAAGGTCTGGTTCAGTGGCACGATATTCATGCATTATCCAATTTGTGCGTTCGCCTTTT
JMFF039B08+ T
                      ____________________________________________________________
consensus TCAAGGTCTGGTTCAGTGGCACGATATTCATGCATTATCCAATTTGTGCGTTCGCCTTTT
 
. : . : . : . : . : . :
JMSF032L04+ GGAGCACGA-CCCTTGTAGAACACCAGAGTCTTCTTTATGCCAATTAATGGGGTATTTGA
JMSF023A24+ GGAGCACGA-CCCTTGTAGAACACCAGAGTCTTCTTTATGCCAATTAATGGGGTATTTGA
JMFF035O04+ GGAGCACGA-CCCTTGTAGAACACCAGAGTCTTCTTTATGCCAATTAATGGGGTATTTGA
JMFF047N17+ GGAGCACGA-CCCTTGTAGAACACCAGAGTCTTCTTTATGCCAATTAATGGGGTATTTGA
JMFF039B08+ GGAGCACGANCCCTTGTAGAACACCAGAGTCTTCTTTATGCCAATTAATGGGGTATTTGA
                      ____________________________________________________________
consensus GGAGCACGA-CCCTTGTAGAACACCAGAGTCTTCTTTATGCCAATTAATGGGGTATTTGA
 
. : . : . : . : . : . :
JMSF032L04+ CTGATCAGAACCAGTGGACTTACGAGTCTTAATAGCCCTGTCTTTGCCTGTGGCCTTCCA
JMSF023A24+ CTGATCAGAACCAGTGGACTTACGAGTCTTAATAGCCCTGTCTTTGCCTGTGGCCTTCCA
JMFF035O04+ CTGATCAGAACCAGTGGACTTACGAGTCTTAATAGCCCTGTCTTTGCCTGTGGCCTTCCA
JMFF047N17+ CTGATCAGAACCAGTGGACTTACGAGTCTTAATAGCCCTGTCTTTGCCTGTGGCCTTCCA
JMFF039B08+ NTGATCAGAACCAGTGGACTTACGAGTCTTAATAGCCCTGTCTTTGCCTGTGGCCTTCCA
                      ____________________________________________________________
consensus CTGATCAGAACCAGTGGACTTACGAGTCTTAATAGCCCTGTCTTTGCCTGTGGCCTTCCA
 
. : . : . : . : . : . :
JMSF032L04+ GTAACCAGCATATGTGGCTCTGTTGCACCTATTACCATTAGGATACTTCCTATCCAGCGG
JMSF023A24+ GTAACCAGCATCTGTGGCTCTGTTGCACCTATTACCATTAGGATACTTCCTATCCAGCGG
JMFF035O04+ GTAACCAGCATCTGTGGCTCTGTTGCACCTATTACCATTAGGATACTTCCTATCCAGCGG
JMFF047N17+ GTAACCAGCATCTGTGGCTCTGTTGCACCTATTACCATTAGGATACTTCCTATCCAGCGG
JMFF039B08+ GTAACCAGCATCTGTGGCTCTGTTGCACCTATTACCATTAGGATACTTCCTATCCAGCGG
                      ____________________________________________________________
consensus GTAACCAGCATCTGTGGCTCTGTTGCACCTATTACCATTAGGATACTTCCTATCCAGCGG
 
. : . : . : . : . : . :
JMSF032L04+ GCAAAAGAAGAACCATTCTGGATCATCTGTCTTAATAACCGACAAACTCGGTAAATCCCA
JMSF023A24+ GCAAAAGAAGAACCATTCTGGATCATCTGTCTTAATAACCGACAAACTCGGTAAATCCCA
JMFF035O04+ GCAAAAGAAGAACCATTCTGGATCATCTGTCTTAATAACCGACAAACTCGGTAAATCCCA
JMFF047N17+ GCAAAAGAAGAACCATTCTGGATCATCTGTCTTAATAACCGACAAACTCGGTAAATCCCA
JMFF039B08+ GCAAAAGAAGAACCATTCTGGATCATCTGTCTTAATAACCGACAAACTCGGTAAATCCCA
                      ____________________________________________________________
consensus GCAAAAGAAGAACCATTCTGGATCATCTGTCTTAATAACCGACAAACTCGGTAAATCCCA
 
. : . : . : . : . : . :
JMSF032L04+ GGGCTCCCACTTGCAGACGTCGACTTCAGGAATGACCTGCACCTCGGAATGGCGGCCATT
JMSF023A24+ GGGCTCCCACTTGCAGACGTCGACTTCAGGAATGACCTGCACCTNGGAATGGCGGCCATT
JMFF035O04+ GGGCTCCCACTTGCAGACGTCGACTTCAGGAATGACCTGCACCTCGGAATGGCGGCCATT
JMFF047N17+ GGGCTCCCACTTGCAGACGTCGACTTCAGGAATGACCTGCACCTCGGAATGGCGGCCATT
JMFF039B08+ GGGCTCCCACTTGCAGACGTCGACTTCAGGAATGACCTGCACCTCGGAATGGCGGCCATT
                      ____________________________________________________________
consensus GGGCTCCCACTTGCAGACGTCGACTTCAGGAATGACCTGCACCTCGGAATGGCGGCCATT
 
. : . : . : . : . : . :
JMSF032L04+ GATCTTACGGCGGAGGTAATGAGAAATGAGCTCCTGGTCCGTCGGCCGGAACCTGAACCC
JMSF023A24+ GATCTTACGGCGGAGGTAATGAGAAATGAGCTCCTGGTCCGTCGGCCGGAACCTGAACCC
JMFF035O04+ GATCTTACGGCGGAGGTAATGAGAAATGAGCTCCTGGTCCGTCGGCCGGAACCTGAACCC
JMFF047N17+ GATCTTACGGCGGAGGTAATGAGAAATGAGCTCCTGGTCCGTCGGCCGGAACCTGAACCC
JMFF039B08+ GATCTTACGGCGGAGGTAATGAGAAATGAGCTCCTGGTCCGTCGGCCGGAACCTGAACCC
                      ____________________________________________________________
consensus GATCTTACGGCGGAGGTAATGAGAAATGAGCTCCTGGTCCGTCGGCCGGAACCTGAACCC
 
. : . : . : . : . : . :
JMSF032L04+ CAACGGCAACGCGTCCATCGACAACCCACTCATTCCCGCTTTACTTCTCTGTGTCTCACC
JMSF023A24+ CAACGGCAACGCGTCCATCGACAACCCACTCATTCCCGCTTTACTTCTCTGTGTCTCACC
JMFF035O04+ CAACGGCAACGCGTCCATCGACAACCCACTCATTCCCGCTTTACTTCTCTGTGTCTCACC
JMFF047N17+ CAACGGCAACGCGTCCATCGACAACCCACTCATTCCCGCTTTACTTCTCTGTGTCTCACC
JMFF039B08+ CAACGGCAACGCGTCCATCGACAACCCACTCATTCCCGCTTTACTTCTCTGTGTCTCACC
                      ____________________________________________________________
consensus CAACGGCAACGCGTCCATCGACAACCCACTCATTCCCGCTTTACTTCTCTGTGTCTCACC
 
. : . : . : . : . : . :
JMSF032L04+ AGATTA
JMSF023A24+ AGATTAAAAAAGGAAAAAGAAAACCTAACCCCTAAAATTCAACTCCTTTCC
JMFF035O04+ AGATT
JMFF047N17+ AGATTAAAAAAGGAAAAAGAAAACCTAACCCCTAAAATTCAACTCCTTTCC
JMFF039B08+ AGATTAAAAAAGGAAAAAGAAAACCTAACCCCTAAAATTCAACTCCTTTCCGCTTTCCCC
                      ____________________________________________________________
consensus AGATTAAAAAAGGAAAAAGAAAACCTAACCCCTAAAATTCAACTCCTTTCCGCTTTCCCC