Previous Contig 001677:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010E05Sequence576001677 (13)pir|T48388|T483881e-44hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid777001677 (13)pir|T48388|T483881e-49hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid
JMFF024D10Sequence514001677 (13)pir|T48388|T483882e-39hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid679001677 (13)pir|T48388|T483882e-50hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid
JMFF038O01Sequence528001677 (13)pir|T48388|T483885e-23hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid657001677 (13)pir|T48388|T483888e-50hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid
JMFN006B20Sequence633001677 (13)pir|T48388|T483887e-53hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid
JMFN019C05Sequence613001677 (13)pir|T48388|T483888e-45hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid
JMSF006K07Sequence298001677 (13)pir|T48388|T483888e-11hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid
JMSF021P05Sequence682001677 (13)pir|T48388|T483881e-45hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid773001677 (13)pir|T48388|T483883e-57hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid
JMSF035E16Sequence658001677 (13)pir|T48388|T483883e-45hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid700001677 (13)pir|T48388|T483887e-52hypothetical protein F17C15.30 - Arabidopsis thaliana>gb:ATF17C15_1548887 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038O01- GTTGAATTCATACAACATAAGGGTCCAA
rJMSF035E16- TACAAAAGTCTCAATTAAACACAAGGTTGAATTCATACAACATAAGGGTCCAA
rJMFF024D10- GTTGAATTCATACAACATAAGGGTCCAA
rJMFF010E05- GTTGAATTCATACAACATAAGGGTCCAA
                      ____________________________________________________________
consensus TACAAAAGTCTCAATTAAACACAAGGTTGAATTCATACAACATAAGGGTCCAA
 
. : . : . : . : . : . :
rJMFF038O01- TATAGACTAAACGGAAGTCTAGCCGTCTAGGGGTTCAAGTGAAAATACGAGGAGTTCATG
rJMSF035E16- TATAGACTAAACGGAAGTCTAGCCGTCTAGGGGTTCAAGTGAAAATACGAGGAGTTCATG
rJMFF024D10- TATAGACTAAACGGAAGTCTAGCCGTCTAGGGGTTCAAGTGAAAATACGAGGAGTTCATG
JMFN006B20+ GGTTCAAGTGAAAATACGAGGAGTTCATG
rJMFF010E05- TATAGACTAAACGGAAGTCTAGCCGTCTAGGGGTTCAAGTGAAAATACGAGGAGTTCATG
rJMSF021P05- AGGAGTTCATG
                      ____________________________________________________________
consensus TATAGACTAAACGGAAGTCTAGCCGTCTAGGGGTTCAAGTGAAAATACGAGGAGTTCATG
 
. : . : . : . : . : . :
rJMFF038O01- AAAACCATACAGAAAGCTAGAACAAGTGTTCATGGAGAGTAGGCTTCAAATAATCATAAA
rJMSF035E16- AAAACCATACAGAAAGCTAGAACAAGTGTTCATGGAGAGTAGGCTTCAAATAATCATAAA
rJMFF024D10- AAAACCATACAGAAAGCTAGAACAAGTGTTCATGGAGAGTAGGCTTCAAATAATCATAAA
JMFN006B20+ AAAACCATACAGAAAGCTAGAACAAGTGTTCATGGAGAGTAGGCTTCAAATAATCATAAA
rJMFF010E05- AAAACCATACAGAAAGCTAGAACAAGTGTTCATGGAGAGTAGGCTTCAAATAATCATAAA
rJMSF021P05- AAAACCATGGTGAAAGCTAGAACAAGTGTTCATGGAGAGTAGGCTTCAAAGCATCATAAA
                      ____________________________________________________________
consensus AAAACCATACAGAAAGCTAGAACAAGTGTTCATGGAGAGTAGGCTTCAAATAATCATAAA
 
. : . : . : . : . : . :
rJMFF038O01- CAGCTGACCACCCTGCCTGGGTCGGGTGACTGCCGTCCCAAAAGAAGGCCGCGTTTGGAT
rJMSF035E16- CAGCTGACCACCCTGCCTGGGTCGGGTGACTGCCGTCCCAAAAGAAGGCCGCGTTTGGAT
rJMFF024D10- CAGCTGACCACCCTGCCTGGGTCGGGTGACTGCCGTCCCAAAAGAAGGCCGCGTTTGGAT
JMFN006B20+ CAGCTGACCACCCTGCCTGGGTCGGGTGACTGCCGTCCCAAAAGAAGGCCGCGTTTGGAT
rJMFF010E05- CAGCTGACCACCCTGCCTGGGTCGGGTGACTGCCGTCCCAAAAGAAGGCCGCGTTTGGAT
rJMSF021P05- TAGCTGACCACCCTACCTGGGTCGGGTGAGCGCCGTCCCAAAAGAAGGCCGCGTTTGGAT
                      ____________________________________________________________
consensus CAGCTGACCACCCTGCCTGGGTCGGGTGACTGCCGTCCCAAAAGAAGGCCGCGTTTGGAT
 
. : . : . : . : . : . :
rJMFF038O01- CACTGCACATCGTGTACATCTTCACCCCATTCTTGTCCACACTGGAGCATTCGTATCCCT
rJMSF035E16- CACTGCACATCGTGTACATCTTCACCCCATTCTTGTCCACACTGGAGCATTCGTATCCCT
rJMFF024D10- CACTGCACATCGTGTACATCTTCACCCCATTCTTGTCCACACTGGAGCATTCGTATCCCT
JMFN006B20+ CACTGCACATCGTGTACATCTTCACCCCATTCTTGTCCACACTGGAGCATTCGTATCCCT
rJMFF010E05- CACTGCACATCGTGTACATCTTCACCCCATTCTTGTCCACACTGGAGCATTCGTATCCCT
rJMSF021P05- CACTGCACATTGTGTACATCTTCACCCCATTCTTGTCCACACTCGAGCAGTCGTATCCCT
                      ____________________________________________________________
consensus CACTGCACATCGTGTACATCTTCACCCCATTCTTGTCCACACTGGAGCATTCGTATCCCT
 
. : . : . : . : . : . :
rJMFF038O01- TGCTTACTCCCACGCAGCATGGCTTCATTGGCGTCTCGAATCTCCTACTACCTTCTTGCC
rJMSF035E16- TGCTTACTCCCACGCAGCATGGCTTCATTGGCGTCTCGAATCTCCTACTACCTTCTTGCC
rJMFF024D10- TGCTTACTCCCACGCAGCATGGCTTCATTGGCGTCTCGAATCTCCTACTACCTTCTTGCC
JMFN006B20+ TGCTTACTCCCACGCAGCATGGCTTCATTGGCGTCTCGAATCTCCTACTACCTTCTTGCC
rJMFF010E05- TGCTTACTCCCACGCAGCATGGCTTCATTGGCGTCTCGAATCTCCTACTACCTTCTTGCC
rJMSF021P05- CGCTTACTCCCGCGCAGCACGGCTTCATTGGCGTCTCGAATCTCCTACTACCTCCTTGTC
                      ____________________________________________________________
consensus TGCTTACTCCCACGCAGCATGGCTTCATTGGCGTCTCGAATCTCCTACTACCTTCTTGCC
 
. : . : . : . : . : . :
rJMFF038O01- GGAGTTTCTTTTGCTTGATGATGGTGATGAAGGGACTATAGAGGTCGAGGATGAAGTATG
rJMSF035E16- GGAGTTTCTTTTGCTTGATGATGGTGATGAAGGGACTATAGAGGTCGAGGATGAAGTATG
rJMFF024D10- GGAGTTTCTTTTGCTTGATGATGGTGATGAAGGGACTATAGAGGTCGAGGATGAAGTATG
JMFN006B20+ GGAGTTTCTTTTGCTTGATGATGGTGATGAAGGGACTATAGAGGTCGAGGATGAAGTATG
rJMFF010E05- GGAGTTTCTTTTGCTTGATGATGGTGATGAAGGGACTATAGAGGTCGAGGATGAAGTATG
rJMSF021P05- GGAGTTTCTTTTGCTTGATGATGGTGATGAAGGGGCTATAGAGGTCGAGGATAAAGTATG
                      ____________________________________________________________
consensus GGAGTTTCTTTTGCTTGATGATGGTGATGAAGGGACTATAGAGGTCGAGGATGAAGTATG
 
. : . : . : . : . : . :
rJMFF038O01- GGGAGCCGGGGGTCTGGCTGTTCAGCCGCGCCACCATTTTCTGCAACATCGAGTTGTGCA
rJMSF035E16- GGGAGCCGGGGGTCTGGCTGTTCAGCCGCGCCACCATTTTCTGCAACATCGAGTTGTGCA
rJMFF024D10- GGGAGCCGGGGGTCTGGCTGTTCAGCCGCGCCACCATTTTCTGCAACATCGAGTTGTGCA
JMFN006B20+ GGGAGCCGGGGGTCTGGCTGTTCAGCCGCGCCACCATTTTCTGCAACATCGAGTTGTGCA
rJMFF010E05- GGGAGCCGGGGGTCTGGCTGTTCAGCCGCGCCACCATTCTCTGCAACATCGAGTTGTGCA
rJMSF021P05- GGGAGCCGGGGGTCTGGCTGTTCAACCGCGCCACCATTTTCTGCAACATCGAGTTGTGCA
                      ____________________________________________________________
consensus GGGAGCCGGGGGTCTGGCTGTTCAGCCGCGCCACCATTTTCTGCAACATCGAGTTGTGCA
 
. : . : . : . : . : . :
rJMFF038O01- GCATGGCACCCTCGTTCAGGCTGTCGTTGCACTGTTGGAAAGATGAATGGGCAGTGATAG
rJMSF035E16- GCATGGCACCCTCGTTCAGGCTGTCGTTGCACTGTTGGAAAGATGAATGGGCAGTGATAG
rJMFF024D10- GCATGGCACCCTCGTTCAGGCTGTCGTTGCACTGTTGGAAAGATGAATGGGCAGTGATAG
JMFN006B20+ GCATGGCACCCTCGTTCAGGCTGTCGTTGCACTGTTGGAAAGATGAATGGGCAGTGATAG
rJMFF010E05- GCATGGCACCCTCGTTCAGGCTGTCGTTGCACTGTTGGAAAGATGAATGGGCAGTGATAG
rJMSF021P05- ACATGGCAACCTCGTTCAGGCTGTCGTTGCACTGTCGGTAAGATGATTGGACAATGGCTC
                      ____________________________________________________________
consensus GCATGGCACCCTCGTTCAGGCTGTCGTTGCACTGTTGGAAAGATGAATGGGCAGTGATAG
 
. : . : . : . : . : . :
rJMFF038O01- TGGGAAGACAACCAAAGGGTTGCATAGACGAGACACTCACTTTCTTGACTCCCATGTTGT
rJMSF035E16- TGGGAAGACAACCAAAGGGTTGCATAGACGAGACACTCACTTTCTTGACTCCCATGTTGT
rJMFF024D10- TGGGAAGACAACCAAAGGGTTGCATAGACGAGACACTCACTTTCTTGACTCCCATGTTGT
JMFN006B20+ TGGGAAGACAACCAAAGGGTTGCATAGACGAGACACTCACTTTCTTGACTCCCATGTTGT
rJMFF010E05- TGGGAAGACAACCAAAGGGTTGCATAGACGAGACACTCACTTTCTTGACTCCCATGTTGT
rJMSF021P05- TAGGAAGACAACCTAAGGGTTGCATAGACGCAATGCTCACTTTCTTGACTCCCATGTTGT
                      ____________________________________________________________
consensus TGGGAAGACAACCAAAGGGTTGCATAGACGAGACACTCACTTTCTTGACTCCCATGTTGT
 
. : . : . : . : . : . :
rJMFF038O01- GGAGGCGCTTCATGTTTGTAGCTATTTGGTTTACCACTCTTTTGGTGTATGCC-GGTAGA
rJMSF035E16- GGAGGCGCTTCATGTTTGTAGCTATTTGGTTTACCACTCTTTTGGTGTATGCC-GGTAGA
rJMFF024D10- GGAGGCGCTTCATGTTTGTAGCTATTTGGTTTACCACTCTTTTGGTGTATGCCGGGTAGA
JMFN006B20+ GGAGGCGCTTCATGTTTGTAGCTATTTGGTTTACCACTCTTTTGGTGTATGCC-GGTAGA
rJMFF010E05- GGAGGCGCTTCATGTTTGTAGCTATTTGGTTTACCACTCTTTTGGTGTATGCC-GGTAGA
rJMSF021P05- GGAGGCGCTTCATGTCTGTAGCTACCTGGTTTATCACTCTTCTGGTATATGCC-GGCAAA
JMSF021P05+ ATGTCTGTAGCTACCTGGTTTATCACTCTTCTGGTATATGCC-GGCAAA
JMSF035E16+ TTGGTGTATGCC-GGTAGA
                      ____________________________________________________________
consensus GGAGGCGCTTCATGTTTGTAGCTATTTGGTTTACCACTCTTTTGGTGTATGCC-GGTAGA
 
. : . : . : . : . : . :
rJMFF038O01- CCCTCTTTAGTGCCACCCATGAATCGA
rJMSF035E16- CCCTCTTTAGTGCCACCCATGAATCGAT-AGGCCGTATAGTCATTGCCA
rJMFF024D10- CCCTCTTTAGTGCCACCCATGAATCGAT-AGGCCGTATAGTCATTGCCACA
JMFN006B20+ CCCTCTTTAGTGCCACCCATGAATCGAT-AGGCCGTATAGTCATTGCCACAAACGGTAAA
rJMFF010E05- CCCTCTTTAGTGCCACCCATGAATCGATNNGGCCGTATAGTCATTGCCACAAACGGTAAA
rJMSF021P05- CCCTCTTTAGTGCCACCAAAGAATAGAT-AGGTCATATAGTCATTGCCACAAACGGTAAG
JMSF021P05+ CCNTCTTTAGTGCCACCAAAGAATAGAT-AGGTCATATAGTCATTGCCACAAACGGTAAG
JMSF035E16+ CCCTCTTTAGTGCCACCCATGAATCGAT-AGGCCGTATAGTCATTGCCACAAACGGTAAA
JMFF010E05+ CACCCATGAATCGAT-AGNCCGTATAGTCATTGCCACAAACGGTAAA
JMFN019C05+ TTAGTGCCACCCATGAATCGAT-AGGCCGTATAGTCATTGCCACAAACGGTAAA
                      ____________________________________________________________
consensus CCCTCTTTAGTGCCACCCATGAATCGAT-AGGCCGTATAGTCATTGCCACAAACGGTAAA
 
. : . : . : . : . : . :
JMFN006B20+ AAAGGC
rJMFF010E05- AAAGGCCATGGGAAGAGTGCAGGTCGGTGTTTGTATATACAGAACCATCAATCAGTTTCT
rJMSF021P05- TGAGGCCAT-GGAAGATTGCAGGTCGGTCTTTGTATACACAGAAGCATCAATCACACTCT
JMSF021P05+ TGAGGCCAT-GGAAGATTGCAGGTCGGTCTTTGTATACACAGAAGCATCAATCACACTCT
JMSF035E16+ AAAGGCCAT-GGAAGAGTGTAGGTCGGTGTTTGTATATACAGAATCATCAATCAGTTTCT
JMFF010E05+ AAAGGCCAT-GGAAGAGTGCAGGTCGGTGTTTGTATATACAGAACCATCAATCAGTTTCT
JMFN019C05+ AAAGGCCAT-GGAAGAGTGCAGGTCGGTGTTTGTATATACAGAATCATCAATCAGTTTCT
                      ____________________________________________________________
consensus AAAGGCCAT-GGAAGAGTGCAGGTCGGTGTTTGTATATACAGAAGCATCAATCAGTTTCT
 
. : . : . : . : . : . :
rJMFF010E05- GTAAAAACCCAATCTGTGTTGTCATGTT
rJMSF021P05- GGAAAAACTCAATCTGTGTTGTCATGTTCAG
JMSF021P05+ GGAAAAACTCAATCTGTGTTGTCATGTTCAGCCCCCCCGGAAGAAATGTAGTATCGAACA
JMSF035E16+ GTAAAAACCCAATCTGTGTTGTCATGTTCAGTC---CCGGAATGAGTGT---ATCAAACA
JMFF010E05+ GTAAAAACCCAATCTGTGTTGTCATGTTCAGTC---CCGGAATGAGTGT---ATCAAACA
JMFF024D10+ AATCTGTGTTGTCATGTTCAGTC---CCGGAATGAGTGT---ATCAAACA
JMFN019C05+ GTAAAAACCCAATCTGTGTTGTCATGTTCAGTC---CCGGAATGAGTGT---ATCAAACA
                      ____________________________________________________________
consensus GTAAAAACCCAATCTGTGTTGTCATGTTCAGTC---CCGGAATGAGTGT---ATCAAACA
 
. : . : . : . : . : . :
JMSF021P05+ CGCCGGAGGCGCCAAATGCAAAGTTCATACCATATTGCAGCCGACGCTTATAAGCATACT
JMSF035E16+ CGCCGGTGCCGCCAAATGCAAAGTTCATACCATATTGCAGCCGACGACGCTGAGCATACT
JMFF010E05+ CGCCGGTGCCGCCAAATGCAAAGTTCATACCATATTGCAGCCGACGACGCTGAGCATACT
JMFF024D10+ CGCCGGTGCCGCCAAATGCAAAGTTCATACCATATTGCAGCCGACGACGCTGAGCATACT
JMFN019C05+ CGCCGGTGCCGCCAAATGCAAAGTTCATACCATATTGCAGCCGACGACGCTGAGCATACT
                      ____________________________________________________________
consensus CGCCGGTGCCGCCAAATGCAAAGTTCATACCATATTGCAGCCGACGACGCTGAGCATACT
 
. : . : . : . : . : . :
JMSF021P05+ TCATCCATCTGAACGGTGTCGGAGACTTCACTCCCAAGAAGCTAGCAATATAATCAGGGA
JMSF035E16+ TCATCCATCTGAACGGTGCCGGAGACTCCACTCCCAAGAATCTAGCAATATAATCAGGGA
JMFF010E05+ TCATCCATCTGAACGGTGCCGGAGACTCCACTCCCAAGAATCTAGCAATATAATCAGGGA
JMFF024D10+ TCATCCATCTGAACGGTGCCGGAGACTCCACTCCCAAGAATCTAGCAATATAATCAGGGA
JMFN019C05+ TCATCCATCTGAACGGTGCCGGAGACTCCACTCCCAAGAATCTAGCAATATAATCAGGGA
JMFF038O01+ ACGGTGCCGGAGACTCCACTCCCAAGAATNTAGCAATATAATCAGGGA
                      ____________________________________________________________
consensus TCATCCATCTGAACGGTGCCGGAGACTCCACTCCCAAGAATCTAGCAATATAATCAGGGA
 
. : . : . : . : . : . :
JMSF021P05+ GGACACGGCCGTCGGAGAAGCGGCCGAATGGCTTTCCGGGGAAGGTGATGCCATAAGGCT
JMSF006K07+ GGAAGGTGATGCCATAAGGCT
JMSF035E16+ GGACACGGCCGTCGGAGAAGCGGCCGAAAGGCTTTCCGGGGAAAGTGATGCCATAAGGCT
JMFF010E05+ GGACACGGCCGTAGGAGAAGCGGCCGAAAGGCTTTCCGGGGAAAGTGATGCCATAAGGCT
JMFF024D10+ GGACACGGCCGTCGGAGAAGCGGCCGAAAGGCTTTCCGGGGAAAGTGATGCCATAAGGCT
JMFN019C05+ GGACACGGCCGTCGGAGAAGCGGCCGAAAGGCTTTCCGGGGAAAGTGATGCCATAAGGCT
JMFF038O01+ GGACACGGCCGTCGGAGAAGCGGCCGAAAGGCTTTCCGGGGAAAGTGATGCCATAAGGCT
                      ____________________________________________________________
consensus GGACACGGCCGTCGGAGAAGCGGCCGAAAGGCTTTCCGGGGAAAGTGATGCCATAAGGCT
 
. : . : . : . : . : . :
JMSF021P05+ GCCTCCAAGAAAATATCTCCGATTTCCGGAAGTTCCCGGTGTCAGAATACGAATCTCCGA
JMSF006K07+ GCCTCCAAGAAAATATCTCCGATTTCCGGAAGTTCCCGGTGTCAGAATACGAATCTCCGA
JMSF035E16+ GCTTCCAAGAAAATGCCTCCAATTTCCGGTAGTTCCCGGTGTCAGAATACGAATCTCCGA
JMFF010E05+ GCTTCCAAGAAAATGCCTCCAATTTCCGGTAGTTCCCGGTGTCAGAATACGAATCTCCGA
JMFF024D10+ GCTTCCAAGAAAATGCCTCCAATTTCCGGTAGTTCCCGGTGTCAGAATACGAATCTCCGA
JMFN019C05+ GCTTCCAAGAAAATGCCTCCAATTTCCGGTAGTTCCCGGTGTCAGAATACGAATCTCCGA
JMFF038O01+ GCTTCCAAGAAAATGCCTCCAATTTCCGGTAGTTCCCGGTGTCAGAATACGAATCTCCGA
                      ____________________________________________________________
consensus GCTTCCAAGAAAATGCCTCCAATTTCCGGTAGTTCCCGGTGTCAGAATACGAATCTCCGA
 
. : . : . : . : . : . :
JMSF021P05+ ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATT-----
JMSF006K07+ ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATT-----
JMSF035E16+ ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATTATAGC
JMFF010E05+ ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATTATAGC
JMFF024D10+ ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATTATAGC
JMFN019C05+ ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATTATAGC
JMFF038O01+ ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATTATAGC
                      ____________________________________________________________
consensus ACACAAACAGCTTGGTCGGTCGGAACCCATTTATTCCGTTCTTCTTGCTGTCATTATAGC
 
. : . : . : . : . : . :
JMSF021P05+ ----ATCGGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
JMSF006K07+ ----ATCGGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
JMSF035E16+ CTGCATCAGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
JMFF010E05+ CTGCATCAGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
JMFF024D10+ CTGCATCAGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
JMFN019C05+ CTGCATCAGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
JMFF038O01+ CTGCATCAGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
                      ____________________________________________________________
consensus CTGCATCAGAAGCATGAACACCGGCGGGATTGCCGATAGTGAGGAGAAAGATGAAGGAGA
 
. : . : . : . : . : . :
JMSF021P05+ AGAAGAGAGG-TTAGAGAGCTTCATGTGAGGGATGGAGACTGGCCGGAGAGCTTTGAAGG
JMSF006K07+ AGAAGAGAGGTTTAGAGAGCTTCATGTGAGGGATGGAGACTGGCCGGAGAGCTTTGAAGG
JMSF035E16+ AGAAGGGAGGTTTAGAGAGCTTCATGTGAGGGATGGTGACTGGCCGGAGAGCTTTGAAGG
JMFF010E05+ AGAAGGGAGGTTTAGAGAGCTTCATGTGAGGGATGGTGACTGGCCGGAGAGCTTT
JMFF024D10+ AGAAGGGAGGTTTAGAGAGCTTCATGTGAGGGATGGTGACTGGCCGGAGAGCTTTGAAGG
JMFN019C05+ AGAAGGGAGGTTTAGAGAGCTTCATGTGAGGGATGGTGACTGGCCGGAGAGCTTTGAAGG
JMFF038O01+ AGAAGGGAGGTTTAGAGAGCTTCATGTGAGGGATGGTGACTGGCCGGAGAGCTTTGAAGG
                      ____________________________________________________________
consensus AGAAGGGAGGTTTAGAGAGCTTCATGTGAGGGATGGTGACTGGCCGGAGAGCTTTGAAGG
 
. : . : . : . : . : . :
JMSF021P05+ TGGCCTGGGGAACTGG
JMSF006K07+ TGGCCTGGGGAACTGG
JMSF035E16+ TGGCCTGGGGAACTGG
JMFF024D10+ TGGCCTGGGGAACTGG
JMFN019C05+ TGGCCTGGGGAACTGGGGATGAAGAAG
JMFF038O01+ TGGCCTGGGGAACTGGGGATGAAGAAGCAGTAGGAACTAGGAATCGCAGTATAGGGTCGG
                      ____________________________________________________________
consensus TGGCCTGGGGAACTGGGGATGAAGAAGCAGTAGGAACTAGGAATCGCAGTATAGGGTCGG
 
. : . : . : . : . : . :
JMFF038O01+ GCCTTAAGTTTGATATATATGGGTATCAACTATCAACTATCAGTGGCCCATTCCATTCAC
                      ____________________________________________________________
consensus GCCTTAAGTTTGATATATATGGGTATCAACTATCAACTATCAGTGGCCCATTCCATTCAC
 
. : . : . : . : . : . :
JMFF038O01+ ACTGAAAAATGTGTTAAGGGCATGACAAAATAAATACACAAATCTCTTTCCATTCACACT
                      ____________________________________________________________
consensus ACTGAAAAATGTGTTAAGGGCATGACAAAATAAATACACAAATCTCTTTCCATTCACACT