Previous Contig 001675:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M12Sequence516001675 (108)gb:AF452015_18008432e-61Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF015H20Sequence561001675 (108)gb:AF452015_18008435e-73Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.665001675 (108)gb:AF452015_18008438e-55Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF018M15Sequence558001675 (108)gb:AF452015_18008432e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.668001675 (108)gb:AF452015_18008435e-52Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF020M17Sequence513001675 (108)gb:AF452015_18008436e-65Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.156021124gb:AF452015_18008433e-10Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF022J08Sequence453001675 (108)gb:AF452015_18008434e-57Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.674001675 (108)gb:AF452015_18008433e-61Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF023F18Sequence456001675 (108)gb:AF452015_18008432e-57Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.661001675 (108)gb:AF452015_18008433e-62Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF024J08Sequence468001675 (108)gb:AF452015_18008438e-60Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.651001675 (108)gb:AF452015_18008431e-59Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF024O05Sequence518001675 (108)gb:AF452015_18008435e-67Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.727001675 (108)gb:AF452015_18008437e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF025B24Sequence558001675 (108)gb:AF452015_18008432e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.621001675 (108)gb:AF452015_18008433e-52Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF028I21Sequence548001675 (108)gb:AF452015_18008432e-72Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF029F10Sequence566001675 (108)gb:AF452015_18008438e-76Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.670001675 (108)gb:AF452015_18008432e-52Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF030A14Sequence510001675 (108)gb:AF452015_18008433e-59Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.493001675 (108)gb:AF452015_18008432e-36Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF031J19Sequence564001675 (108)gb:AF452015_18008433e-75Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.671001675 (108)gb:AF452015_18008431e-61Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF032B22Sequence557001675 (108)gb:AF452015_18008438e-73Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.673001675 (108)gb:AF452015_18008433e-54Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF032E18Sequence562001675 (108)gb:AF452015_18008439e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF033A14Sequence553001675 (108)gb:AF452015_18008439e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.525001675 (108)gb:SST242805_17226002e-21Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP).
JMFF034F13Sequence558001675 (108)gb:AF452015_18008432e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.727001675 (108)gb:AF452015_18008432e-75Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF035F11Sequence508001675 (108)gb:AF452015_18008432e-65Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.732001675 (108)gb:AF452015_18008432e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF035H06Sequence560001675 (108)gb:AF452015_18008439e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.578001675 (108)gb:AF452015_18008435e-46Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF035K10Sequence558001675 (108)gb:AF452015_18008439e-74Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.671001675 (108)gb:AF452015_18008438e-55Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF036F11Sequence514001675 (108)gb:AF452015_18008432e-65Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.702001675 (108)gb:AF452015_18008431e-64Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF036K11Sequence500001675 (108)gb:AF452015_18008431e-63Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.619001675 (108)gb:SST242805_17226002e-34Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP).
JMFF037L10Sequence570001675 (108)gb:AF452015_18008438e-76Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.718001675 (108)gb:AF452015_18008437e-67Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF038N23Sequence550001675 (108)gb:AF452015_18008433e-71Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.674001675 (108)gb:AF452015_18008433e-60Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF039L15Sequence512001675 (108)gb:AF452015_18008436e-65Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.657001675 (108)gb:AF452015_18008431e-55Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF042N21Sequence636001675 (108)gb:AF452015_18008432e-90Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF043B21Sequence643001675 (108)gb:AF452015_18008432e-90Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.624001675 (108)gb:AF452015_18008434e-46Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF048D10Sequence321001675 (108)gb:AF452015_18008431e-36Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.295001675 (108)
JMFF049P03Sequence613001675 (108)gb:AF452015_18008431e-83Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.616001675 (108)gb:AF452015_18008436e-49Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFF050P16Sequence608001675 (108)gb:AF452015_18008431e-83Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.557001675 (108)gb:AF452015_18008437e-37Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN006L17Sequence628001675 (108)gb:AF452015_18008434e-91Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN009A17Sequence615001675 (108)gb:AF452015_18008432e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN010B11Sequence642001675 (108)gb:AF452015_18008433e-98Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN011B06Sequence590001675 (108)gb:AF452015_18008435e-86Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN011P10Sequence604001675 (108)gb:AF452015_18008431e-92Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN014E08Sequence627001675 (108)gb:AF452015_18008434e-91Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN018M03Sequence610001675 (108)gb:AF452015_18008439e-89Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN019O24Sequence304001675 (108)gb:AF452015_18008433e-34Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN025F02Sequence624001675 (108)gb:AF452015_18008432e-90Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN025O16Sequence628001675 (108)gb:AF452015_18008432e-90Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN028M13Sequence609001675 (108)gb:AF452015_18008431e-94Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN029I08Sequence608001675 (108)gb:AF452015_18008432e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN032F08Sequence629001675 (108)gb:AF452015_18008432e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN033M02Sequence595001675 (108)gb:AF452015_18008431e-83Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN035H11Sequence585001675 (108)gb:AF452015_18008435e-83Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN038I23Sequence626001675 (108)gb:AF452015_18008436e-96Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN039J07Sequence621001675 (108)gb:AF452015_18008432e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN039M20Sequence609001675 (108)gb:AF452015_18008431e-86Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN040E14Sequence617001675 (108)gb:AF452015_18008431e-86Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN042D05Sequence594001675 (108)gb:AF452015_18008431e-86Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN043E18Sequence474001675 (108)gb:AF452015_18008432e-68Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN043N03Sequence572001675 (108)gb:AF452015_18008432e-79Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN043P14Sequence591001675 (108)gb:AF452015_18008434e-88Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN044B12Sequence616001675 (108)gb:AF452015_18008437e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFN044E15Sequence572001675 (108)gb:AF452015_18008432e-79Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS006H10Sequence559001675 (108)gb:AF452015_18008436e-81Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS017C04Sequence606001675 (108)gb:AF452015_18008433e-88Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS038H05Sequence628001675 (108)gb:AF452015_18008432e-90Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS049G09Sequence627001675 (108)gb:AF452015_18008434e-94Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS061H06Sequence615001675 (108)gb:AF452015_18008437e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS068A06Sequence608001675 (108)gb:AF452015_18008433e-85Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS068G05Sequence608001675 (108)gb:AF452015_18008433e-85Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS123G07Sequence563001675 (108)gb:AF452015_18008432e-79Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS147C06Sequence610001675 (108)gb:AF452015_18008436e-86Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS153G04Sequence612001675 (108)gb:AF452015_18008432e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMFS169F02Sequence545001675 (108)gb:AF452015_18008434e-46Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMSF013L16Sequence500001675 (108)gb:AF452015_18008431e-63Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.236001675 (108)
JMSF017B20Sequence298001675 (108)gb:AF452015_18008434e-29Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.664001675 (108)gb:AF452015_18008433e-55Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMSF026B13Sequence668001675 (108)gb:AF452015_18008434e-87Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMSF029E11Sequence708001675 (108)gb:AF452015_1800843e-100Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.647001675 (108)gb:AF452015_18008433e-53Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMSF032D03Sequence712001675 (108)gb:AF452015_1800843e-102Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.660001675 (108)gb:AF452015_18008438e-63Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMSF038G07Sequence561001675 (108)gb:AF452015_18008433e-75Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.651001675 (108)gb:SST242805_17226003e-26Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP).
JMSF040K09Sequence693001675 (108)gb:AF452015_18008439e-98Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.821001675 (108)gb:AF452015_18008431e-88Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMSF045F21Sequence788001675 (108)gb:AF452015_1800843e-115Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.727001675 (108)gb:AF452015_18008436e-73Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.
JMSF047E03Sequence711001675 (108)gb:AF452015_1800843e-101Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.597001675 (108)gb:AF452015_18008431e-29Petunia x hybrida aquaporin-like protein (TIP1;1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043B21- CCTTATGGCGGATCACCCTGGAGAGXXXXXXXXXXXXXXXXXXXXXCAAAAGAAAAA
rJMSF047E03- AAAA
rJMSF038G07- CAAAAGAAAAA
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGNNNNNNNNNNNNNNNNNNNNNCAAAAGAAAAA
 
. : . : . : . : . : . :
rJMFF050P16- TTATATATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF043B21- CATGCTTATATATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMSF047E03- CATGCTTATATATAAATGATACACTA-TTTCGACATTGACATACACNTT-GAAAAGAAAC
rJMSF038G07- CATGCTTATATATAAATGATACACTATTTTCGACATTGACATACACATT-GAAAAGAAAC
rJMSF013L16- TTGACATACNCTTT-GAAAAGAAAC
rJMFF024J08- TAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF037L10- ATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF035F11- CTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMSF029E11- ACATACACATTGGAAAAGAAAC
rJMSF045F21- CACTA-TTTCGACATTGACATACACATTGGAAAAGAAAC
rJMFF036F11- TA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF024O05- CTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF039L15- TA-TTTCGAC-TTGACATACACATT-GAAAAGAAAC
rJMFF030A14- A-TTTCGAC-TTGAC-TACACATT-GAAAAGAAAC
rJMFF034F13- TA-TTTCGAC-TTGACATACACATT-GAAAAGAAAC
rJMSF032D03- ACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMSF017B20- GATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF036K11- AAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF029F10- TATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF035K10- ATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF031J19- ATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF032B22- TATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF038N23- TTATATATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF035H06- TATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF018M15- TATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF015H20- ATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF022J08- TATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF023F18- CTA-TTTCGAC-TTGACATACACATT-GAAAAGAAAC
rJMFF025B24- ATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF049P03- TTATATATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
rJMFF048D10- TTATATATAAATGATACACTA-TTTCCACCTTGACATACCCCTT-GAAAAGAAAC
rJMSF040K09- CTTATATATAAATGATACACTAGTTTCGACATTGACATACACATT-GAAAAGAAAC
                      ____________________________________________________________
consensus CATGCTTATATATAAATGATACACTA-TTTCGACATTGACATACACATT-GAAAAGAAAC
 
. : . : . : . : . : . :
rJMFF050P16- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF043B21- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMSF047E03- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAANTCNCANNGNGTACAA
rJMSF038G07- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAANTCNCAANGAGTACAA
rJMSF013L16- NTANCTAANCGAAACCCGAA--NAAAAAAAAAGCTCNTAANTAAATCACANNGAGTACAA
rJMFF024J08- ATAACTAAACGAAACCCGAAG--AAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF037L10- ATAACTAAACGAAACCCGAAG--AAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF035F11- ATAACTAAACGAAACCCGAAG-AAAAAAAAAGGCTCATAAATAAATCACAATGAGTACAA
rJMSF029E11- ATAACTAAACGAAACCCGAAGAAAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMSF045F21- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF036F11- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF024O05- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF039L15- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF030A14- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF034F13- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMSF032D03- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMSF017B20- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF036K11- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF029F10- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF035K10- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF031J19- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF032B22- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF038N23- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF035H06- ATAACTAAACGAAACCCGAAGAAAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF018M15- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF015H20- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF033A14- TGAGTACAA
rJMFF022J08- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF023F18- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF025B24- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF049P03- ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
rJMFF048D10- ATAACTAAACGAAACCCGAA--AAAAAAAAAAGCTCATAAATAACTCCCAATGAGTACAA
rJMSF040K09- ATAACTAAACGAAACCCGAA--GAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
                      ____________________________________________________________
consensus ATAACTAAACGAAACCCGAAG-AAAAAAAAAAGCTCATAAATAAATCACAATGAGTACAA
 
. : . : . : . : . : . :
rJMFF050P16- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAGAGCTCTCCACCCAACAATGCAACA
rJMFF043B21- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAGAGCTCTCCACCCAACAATGCAACA
rJMSF047E03- A-TGANAANATNGGGGTTGCAGTTTTTATTTATTANAGCTCTCCNCCCAACAANGCAACA
rJMSF038G07- A-TGAGAANATNGGGGTTGCAGTTTTTATTTATTANAGCTCTCCNCCCAACAANGCAACN
rJMSF013L16- A-TGANAANATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCNCCCAANANNGCAACA
rJMFF024J08- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAGAGCTCTCCACCCAACAATGCAACA
rJMFF037L10- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAGAGCTCTCCACCCAACAATGCAACA
rJMFF035F11- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAGAGCTCTCCACCCAACAATGCAACA
rJMSF029E11- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMSF045F21- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMFF036F11- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF024O05- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMFF039L15- A-TGAGAANATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMFF030A14- A-TGAGAANATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMFF034F13- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMSF032D03- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMSF017B20- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMFF036K11- N-TGAGAANATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF029F10- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF035K10- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF031J19- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF032B22- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF038N23- A-TGAGAANATAGGGGTTGCAGTTTTTATTTATTANAGCTCTCCACCCAACAATGCAACA
rJMFF035H06- A-TGANAANATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF018M15- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF015H20- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF033A14- N-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGNTCTCCACCCAACANTGCAACA
rJMFF022J08- A-TGAGAANATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF023F18- AGTGAGAANATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF025B24- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
rJMFF049P03- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAGAGCTCTCCACCCAACAATGCAACA
rJMFF048D10- A-TGAAAACATAGGGGTTGCCGTTTTTATTTATTAAAGCTCTCCCCCCAAAAATGGAACA
rJMSF040K09- A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAGAGCTCTCCACCCAACAATGCAACA
                      ____________________________________________________________
consensus A-TGAGAAGATAGGGGTTGCAGTTTTTATTTATTAAAGCTCTCCACCCAACAATGCAACA
 
. : . : . : . : . : . :
rJMFF050P16- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF043B21- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMSF047E03- CCTATCTTCCTAGACNGAACGTAANGGAAACTAATAAANAATCNCCCGACNCATANAATT
rJMSF038G07- CCTATCTTCCTAGACNGAACGTAANGGAAACTAATAAANAATCNCCCGACNCATANAATT
rJMSF013L16- CCTATNTTCCTANACAGAANGTAANGGAAACTAANAAAGAATCCCCCGACNCATANAATT
rJMFF024J08- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF037L10- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF035F11- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMSF029E11- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCNCCCGACACATAGAATT
rJMSF045F21- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF036F11- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF024O05- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF039L15- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF030A14- CCTATCTTCCTANACAGAACGCAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF034F13- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMSF032D03- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMSF017B20- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF036K11- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATANAATT
rJMFF029F10- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF035K10- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF031J19- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF032B22- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF038N23- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF035H06- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAANAATCNCCCGACACATAGAATT
rJMFF018M15- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAANAATCACCCGACACATAGAATT
rJMFF015H20- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATANAATT
rJMFF033A14- CCTATCTTCNTANACANAACGTAAAGGAAANTANTAAANANTCNCCCGACNCNTAAAATT
rJMFF022J08- CCTATCTTCCTANACAGAACGTAAAGGAAACTAATAAANAATCACCCGACACATAGAATT
rJMFF023F18- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
JMFS017C04+ ATAAAGAATCACCCGACACATAGAATT
rJMFF025B24- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAANAATCACCCGACACATAGAATT
rJMFF049P03- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
rJMFF048D10- CCTATCTTTCTAAACGGAACGTAAAGGAAACTATTAAAGAATCCCCCGACACATAGAATT
rJMSF040K09- CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
                      ____________________________________________________________
consensus CCTATCTTCCTAGACAGAACGTAAAGGAAACTAATAAAGAATCACCCGACACATAGAATT
 
. : . : . : . : . : . :
rJMFF050P16- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF043B21- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMSF047E03- GNGATTTGACTCANCCTGCAGGCTCACAANGGCTCGGGGGTAGGGNGACCGATGAACAAN
rJMSF038G07- GNGATTTGACTCANCCTGCAGGCTCACAANGGCTCGGGGGTAGGGNGACCGATGAACAAN
rJMSF013L16- GNGNTTTGACTCANCCTGCNGGCTCNCAATGGCTC
rJMFF024J08- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF037L10- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF035F11- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMSF029E11- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGNGGGTAGGGTGACCGATGAACAAG
rJMSF045F21- GTGGTTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF036F11- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF024O05- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF039L15- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF030A14- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF034F13- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMSF032D03- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMSF017B20- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGNGGGTAGGGTGACCGATGAACAAG
rJMFF036K11- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGNGGGTAGGGTGACCGATGAACAAN
rJMFF029F10- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF035K10- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF031J19- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF032B22- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF038N23- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF035H06- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGNGGGTAGGGTGACCGATGAACAAN
rJMFF018M15- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF015H20- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF033A14- GTGATTTGANTCANCNTGCAGGNTCACAATGGNTCGNGGGTAGGGNGACCGATGAACAAA
rJMFF022J08- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF023F18- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
JMFS017C04+ GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF025B24- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAN
rJMFF049P03- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
rJMFF048D10- GTGATTTGACTCCACCTGCAGGCCCCCAATGGC
rJMSF040K09- GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
JMSF045F21+ AGGGTGACCGATGAACAAG
                      ____________________________________________________________
consensus GTGATTTGACTCAACCTGCAGGCTCACAATGGCTCGTGGGTAGGGTGACCGATGAACAAG
 
. : . : . : . : . : . :
rJMFF050P16- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF043B21- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMSF047E03- ANTTCATANACAACNCCAGCAAGCCCTCCNCCAACGATGGGTCCCAACCAGTAAACCCAG
rJMSF038G07- AGTTCATAGACAACNCCAGCANGCCCTCCNCCANCGATGGGNCCCAACCAGTAAACCCAG
rJMFF024J08- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF037L10- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF035F11- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMSF029E11- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMSF045F21- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF036F11- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF024O05- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF039L15- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF030A14- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF034F13- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMSF032D03- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMSF017B20- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAGCCCAG
rJMFF036K11- AGTTCNTANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF029F10- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF035K10- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF031J19- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF032B22- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF038N23- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF035H06- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF018M15- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF015H20- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF033A14- AGTTCNTAAACAACACCAGCAAGCCCTCCACCAACNATGGGTCCCAACCAGNAAACCCAG
rJMFF022J08- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF023F18- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
JMFS017C04+ AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF025B24- AGTTCATANACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMFF049P03- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
rJMSF040K09- AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
JMSF045F21+ AGTTCATAGACAACACCAGCAAGCCNTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
                      ____________________________________________________________
consensus AGTTCATAGACAACACCAGCAAGCCCTCCACCAACGATGGGTCCCAACCAGTAAACCCAG
 
. : . : . : . : . : . :
rJMFF050P16- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF043B21- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMSF047E03- NGGCAGGACCANTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCANGGAT
rJMSF038G07- NGGCAGGACCAGTTCCNGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCANGGAT
rJMFF024J08- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF037L10- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF035F11- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMSF029E11- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMSF045F21- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF036F11- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF024O05- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF039L15- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF030A14- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF034F13- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMSF032D03- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMSF017B20- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF036K11- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCNAACGCAACGGCCGGGTTCATGGAT
rJMFF029F10- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF035K10- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF031J19- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF032B22- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF038N23- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF035H06- NGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF018M15- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF015H20- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF033A14- NGGCAGGACCANTTCCAGNTAACCAACNATGGCCCNAACNCAACGGCCGGGTTCNTGGAT
rJMFF022J08- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF023F18- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
JMFS017C04+ TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF025B24- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMFF049P03- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
rJMSF040K09- TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
JMSF045F21+ TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
JMSF029E11+ GACCANTTCCAGNTAACCAACGATGGCCCGAACGCAACGGCCGGNTTCATGGAT
JMSF040K09+ ACCAACGATGGCCCGAACGCAACGNCCGGGTTCATGGAT
JMSF026B13+ CGGGTACATGGAT
JMFN010B11+ TAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
JMFS049G09+ GCCGGGTTCATGGAT
JMFN028M13+ CGGCCGGGTTCATGGAT
JMFN011P10+ CATGGAT
JMFN038I23+ CGAACGCAACGGCCGGGTTCATGGAT
JMSF032D03+ CAGGACCANTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
JMSF047E03+ GGACCAGTTCCAGNTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
                      ____________________________________________________________
consensus TGGCAGGACCAGTTCCAGCTAACCAACGATGGCCCGAACGCAACGGCCGGGTTCATGGAT
 
. : . : . : . : . : . :
rJMFF050P16- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF043B21- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMSF047E03- GCTCCAGTGAAGGCNCCNCCGGCNANAATGTTGGCNCCCNCNATGAAACCAANGGCGAGG
rJMSF038G07- GCTCCAGNGAAGGCGCCNCCGGCNANAANGTTGGCNCCCNCNATGAANCCANNGGCGAGG
rJMFF024J08- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF037L10- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF035F11- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMSF029E11- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMSF045F21- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGCTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF036F11- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF024O05- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF039L15- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF030A14- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACNATGAAACCAATGGCGAGG
rJMFF034F13- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMSF032D03- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMSF017B20- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF036K11- GCTCCAGTGAAGGCGCCNCCGGCNANAATGTTGGCACCCACNATGAAACCAATGGCNAGG
rJMFF029F10- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF035K10- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF031J19- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF032B22- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF038N23- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF035H06- GCTCCAGTGAAGGCGCCNCCGGCNAAAATGTTGGCACCCACNATGAAACCAATGGCGAGG
rJMFF018M15- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACNATGAAACCAATGGCGAGG
rJMFF015H20- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF033A14- GCTCCANNGAAGGCNCCNCCGGCNAAAATGTTGGCNCCCNCNATGAAACCANTGGCNAGG
rJMFF022J08- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF023F18- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFS017C04+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMFF025B24- GCTCCAGTGAAGGCGCCGCCGGCGANAATGTTGGCACCCACNATGAAACCAATGGCGAGG
rJMFF049P03- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
rJMSF040K09- GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMSF045F21+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGCTGGCACCCACGATGAAACCAATGGCGAGG
JMFF043B21+ AGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN014E08+ TCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN006L17+ TCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFF050P16+ GATGAAACCAATGGCGAGG
JMSF029E11+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMSF040K09+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMSF026B13+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN025F02+ AGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN039J07+ CGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFS061H06+ CGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN009A17+ GGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN040E14+ CCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN044B12+ CGGCGAGAATGTTGCCACCCACGATGAAACCAATGGCGAGG
JMFS153G04+ CCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFS147C06+ ATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN018M03+ GCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN039M20+ GAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFS068A06+ TGGCACCCACGATGAAACCAATGGCGAGG
JMFN033M02+ GATGAAACCAATGGCGAGG
JMFN042D05+ CGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN043P14+ CCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN035H11+ GATGAAACCAATGGCGAGG
JMFS006H10+ CGAGG
JMFF042N21+ AGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN010B11+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFS038H05+ CCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN025O16+ CCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFS049G09+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN028M13+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN011P10+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN038I23+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN032F08+ CGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN029I08+ CCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFS068G05+ ATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFN011B06+ ATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMSF032D03+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMSF047E03+ GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
JMFF049P03+ GATGAAACCAATGGCGAGG
                      ____________________________________________________________
consensus GCTCCAGTGAAGGCGCCGCCGGCGAGAATGTTGGCACCCACGATGAAACCAATGGCGAGG
 
. : . : . : . : . : . :
rJMFF050P16- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGC
rJMFF043B21- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
rJMSF047E03- GGCGCANTCGTTCCCAAATCTCCCTTCTTTGGGTCANNGGNGGNGGCGTAAACGGNGTAC
rJMSF038G07- GGNGCANTCGTTCCCAAATCTCCCTTCTTTGGGTCANNGGCGGNGGCGTAAACGGNGTAC
rJMFF024J08- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTANACGGTGTAC
rJMFF037L10- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
rJMFF035F11- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
rJMSF029E11- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMSF045F21- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMFF036F11- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGNGGCGTANACGGTGTAC
rJMFF024O05- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMFF039L15- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGNGGCGTAAACGGTGTAC
rJMFF030A14- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGT
rJMFF034F13- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMSF032D03- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
rJMSF017B20- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMFF036K11- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGNGGCGTAAACGGNGTAC
rJMFF029F10- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGNGTAC
rJMFF035K10- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGNGTAC
rJMFF031J19- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTANACGGTGTAC
rJMFF032B22- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGNGGCGTANAAGGTGTAC
rJMFF038N23- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMFF035H06- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGNGGCGTAAACGGTGTAC
rJMFF018M15- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMFF015H20- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMFF033A14- GGCGCAATCGTTCCCAAATCTCCCTTNTTTGGGTCAATGGCGGNGGCGNAAACGGNGTAC
rJMFF022J08- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
rJMFF023F18- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGTGTAC
JMFS017C04+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
rJMFF025B24- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAAACGGNGTAC
rJMFF049P03- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
rJMSF040K09- GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMSF045F21+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF043B21+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN014E08+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN006L17+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF050P16+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMSF029E11+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMSF040K09+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMSF026B13+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN025F02+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN039J07+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS061H06+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN009A17+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN040E14+ GGCGCAATCGTTCCCAAATCTCCCTTCTNTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN044B12+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS153G04+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS147C06+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN018M03+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN039M20+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGAGGTGGCGTAGACGGTGTAC
JMFS068A06+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN033M02+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN042D05+ GGCGCAATCGTTCCCAAATCTCCCTTCTNTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN043P14+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN035H11+ GGCGCAATCGTTCCCAAATCTCCCTTCTNTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN044E15+ GCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS123G07+ GCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS006H10+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF042N21+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN010B11+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS038H05+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN025O16+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS049G09+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN028M13+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN011P10+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN038I23+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN032F08+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN029I08+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFS068G05+ GGCGCAATCGTTCCCAAATCTCCCTTCTNTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN011B06+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFN043N03+ GCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMSF032D03+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMSF047E03+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF049P03+ GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMSF038G07+ TTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF032E18+ GGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF031J19+ TTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF029F10+ CTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF035K10+ AATGGCGGTGGCGTAGACGGTGTAC
JMFF034F13+ GGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF025B24+ GTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF018M15+ GGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF035H06+ AATGGCGGTGGCGTAGACGGTGTAC
JMFF015H20+ GGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF032B22+ ATGGCGGTGGCGTAGAAGGTGTAC
JMFF033A14+ AATGGCGGTGGCGTAGACGGTGTAC
JMFF028I21+ GGCGTAGACGGTGTAC
JMFS169F02+ CTTTGGGTCAACGGCGGTGGCGTAGACGGTGTAC
JMFF037L10+ TTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
JMFF038N23+ GTAGACGGTGTAC
                      ____________________________________________________________
consensus GGCGCAATCGTTCCCAAATCTCCCTTCTTTGGGTCAATGGCGGTGGCGTAGACGGTGTAC
 
. : . : . : . : . : . :
rJMFF043B21- ACCAGCCCAAAGGTCATCACAATCTCAAACA
rJMSF047E03- NCCANCCCAAAGGTCNTCACAATCTCAAACACAAGAGCGCTCCATAC
rJMSF038G07- NCCANCCCAANGGTCNTCNCAATCTCAAACNCAANAGCGCTCCNTACANATACTCCGCTT
rJMFF024J08- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMFF037L10- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMFF035F11- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMSF029E11- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMSF045F21- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMFF036F11- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMFF024O05- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMFF039L15- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMFF034F13- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMSF032D03- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMSF017B20- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMFF036K11- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMFF029F10- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMFF035K10- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACANATACTCCGCTT
rJMFF031J19- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMFF032B22- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACANATACTCCGCTT
rJMFF038N23- ACCANCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMFF035H06- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGAT
rJMFF018M15- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACAGATACTCCGCTT
rJMFF015H20- ACCAGCCCAAAGGTCATCACAATCTCAAACACAANAGCGCTCCATACANATACTCCGCTT
rJMFF033A14- NCCANCCCAAAGGTCNTCACAATCTCAAACACAAAAGCGCTCCATACAAATACTCCGCTT
rJMFF022J08- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAAAGCGCTCCATACAGATACTCCGCTT
rJMFF023F18- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS017C04+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
rJMFF025B24- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACANATACTCCGCTT
rJMFF049P03- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATA
rJMSF040K09- ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF045F21+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF043B21+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN014E08+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN006L17+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF050P16+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF029E11+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF040K09+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF026B13+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN025F02+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN039J07+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS061H06+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN009A17+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN040E14+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN044B12+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS153G04+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS147C06+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN018M03+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN039M20+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS068A06+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN033M02+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN042D05+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN043P14+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN035H11+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN044E15+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS123G07+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS006H10+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF042N21+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN010B11+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS038H05+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN025O16+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS049G09+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN028M13+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN011P10+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN038I23+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN032F08+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN029I08+ ACCAGCCCAAAGGTCATCACAATTTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS068G05+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN011B06+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN043N03+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF035F11+ AATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF032D03+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF047E03+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF049P03+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF038G07+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF032E18+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF031J19+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF029F10+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF035K10+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF034F13+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF025B24+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF024O05+ AGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF036K11+ ACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFN043E18+ AGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF018M15+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF035H06+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF015H20+ CCCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATCCTCCGCTT
JMFF036F11+ CAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF032B22+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF033A14+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF028I21+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF039L15+ TCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF006M12+ TCATCACAATNTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMSF013L16+ CACAAGAGCGCTCCATACAGATACTCCGCTT
JMFS169F02+ ACCAGCCCAAAGGTCTTCTCAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF037L10+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF030A14+ TCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF020M17+ ATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
JMFF038N23+ ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
                      ____________________________________________________________
consensus ACCAGCCCAAAGGTCATCACAATCTCAAACACAAGAGCGCTCCATACAGATACTCCGCTT
 
. : . : . : . : . : . :
rJMSF038G07- AAACCAAATGA-CCCTGTTGGCAANCCGGTTGAAAGCT
rJMFF024J08- AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF037L10- AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF035F11- AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMSF029E11- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMSF045F21- AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF036F11- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF024O05- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF039L15- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF034F13- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMSF032D03- AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMSF017B20- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF036K11- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGC
rJMFF029F10- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF035K10- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF031J19- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF032B22- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF038N23- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF018M15- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF015H20- ANACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF033A14- AAACCAAATGA-CCCTGTTGGCAANCCGGTTGAAAG
rJMFF022J08- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF023F18- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS017C04+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
rJMFF025B24- AAACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGC
rJMSF040K09- AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF045F21+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF043B21+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN014E08+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN006L17+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF050P16+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF029E11+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF040K09+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF026B13+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN025F02+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN039J07+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS061H06+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN009A17+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN040E14+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN044B12+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS153G04+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS147C06+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN018M03+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN039M20+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS068A06+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN033M02+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN042D05+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN043P14+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN035H11+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN044E15+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS123G07+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS006H10+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF042N21+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN010B11+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS038H05+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN025O16+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS049G09+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN028M13+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN011P10+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN038I23+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN032F08+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN029I08+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS068G05+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN011B06+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN043N03+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF035F11+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF032D03+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF047E03+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF049P03+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF038G07+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF032E18+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF031J19+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF029F10+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF023F18+ GCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF035K10+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF034F13+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF025B24+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF024O05+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF036K11+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFN043E18+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF018M15+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF035H06+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF015H20+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF036F11+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF032B22+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF033A14+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF028I21+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF039L15+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF006M12+ AGACCAAATGACCCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMSF013L16+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF024J08+ AAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFS169F02+ AGACCAAATGC-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGTAGGAAGCAAGCACCAGT
JMFF022J08+ GCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF037L10+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF030A14+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF020M17+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
JMFF038N23+ AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
                      ____________________________________________________________
consensus AGACCAAATGA-CCCTGTTGGCAAGCCGGTTGAAAGCTCGAGGAGGAAGCAAGCAACAGT
 
. : . : . : . : . : . :
rJMFF024J08- TGAGCCAAG
rJMFF037L10- TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGGAAAGAANGTGATGTTGCCG
rJMFF035F11- TGAGCCAAGCAGCTGAGCAATGACGTA-AAGAAGGCCGCGG-AAAAAAGTGATGTTGCCG
rJMSF029E11- TGAGCCAAGCAGCTGAGCAATGACGTA
rJMSF045F21- TGAGCCAAGCAGCTGAGCAATGACGTA-AAGAAGGCCGCGG-AANAAGGTGATGTTGCCG
rJMFF036F11- TGAGCCAAGCAGCTGAGCAATGACGTA-AANAAGGCCGCGGAAAAAAGGTGATGTTGCCG
rJMFF024O05- TGAGCCAAGCAGCTGAGCAATGACGTA-AANAAGGCCGCGG-AAAAANGTGATGTTGCCG
rJMFF039L15- TGAGCCAAGCAGCTGAGCAATGAC
rJMFF034F13- TGAGCCAAGCAGCTGAGCAATGACGTA-AAGAAGGCCGCGG-AAAAAGGTGATGTTGCCG
rJMSF032D03- TGAGCCAAGCAGCTGAGCAATGACGTA
rJMSF017B20- TGAGCCAAGCAGCTGAGCAATGACGT
rJMFF029F10- TGAGCCAAGCAGCTGAGCAATGACG
rJMFF035K10- TGAGCCAAGCAGCTGAGCAATGACGTA
rJMFF031J19- TGAGCCAAGCAGCTGAGCAATGACGTA
rJMFF032B22- TGAGCCAAGCAGCTGAGCAATGACGTA-A
rJMFF038N23- TGAGCCAAGCAGCTGAGCAATGAC
rJMFF018M15- TGAGCCAAGCAGCTGAGCAATGA
rJMFF015H20- TGAGCCAAGCAGCTGAGCAATGACGTA-A
rJMFF022J08- TGAGCCAAGCAGCCTAGCAATGACGTA-AA
rJMFF023F18- TGAGCCAAGCAGCTGAGCAATGACGTA-AA
JMFS017C04+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
rJMSF040K09- TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF045F21+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF043B21+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN014E08+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN006L17+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF050P16+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF029E11+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF040K09+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF026B13+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN025F02+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN039J07+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS061H06+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN009A17+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN040E14+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN044B12+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS153G04+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS147C06+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN018M03+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN039M20+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS068A06+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN033M02+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN042D05+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN043P14+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN035H11+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN044E15+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS123G07+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS006H10+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF042N21+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN010B11+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS038H05+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN025O16+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS049G09+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN028M13+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN011P10+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN038I23+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN032F08+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN029I08+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS068G05+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN011B06+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN043N03+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF035F11+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF032D03+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF047E03+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF049P03+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF038G07+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF032E18+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AGGAAGGTGATGTTGCCG
JMFF031J19+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF029F10+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF023F18+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF035K10+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF034F13+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF025B24+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF024O05+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF036K11+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFN043E18+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF018M15+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF035H06+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF015H20+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF036F11+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF032B22+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF033A14+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF028I21+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF039L15+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF006M12+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMSF013L16+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF024J08+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFS169F02+ TGAGCCAAGCAGCTGAGCAATGACGTATGAGAAGGCCGCGG-AAGAAGGTGATGTTTCCG
JMFF022J08+ TGAGCCAAGCAGCCTAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF037L10+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF030A14+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF020M17+ TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
JMFF038N23+ TGAGCCAAGCAGNTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
                      ____________________________________________________________
consensus TGAGCCAAGCAGCTGAGCAATGACGTA-GAGAAGGCCGCGG-AAGAAGGTGATGTTGCCG
 
. : . : . : . : . : . :
rJMFF037L10- CCNACAAAGGCGCCGA
rJMFF035F11- CCAACAAAGGCGCCGAAAGTGACGGCGGGGGTTGACGTGGCC
rJMSF045F21- CCAACAAAGGCGCCNAAAGTGACGGC-GGGGTTGA
rJMFF036F11- CCAACAAAGGCG
rJMFF024O05- CCAACAAAGGCGCCGAAAGTGACNGC-GGGGTTGACGT
rJMFF034F13- CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGG
JMFS017C04+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
rJMSF040K09- CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF045F21+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF043B21+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN014E08+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN006L17+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF050P16+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF029E11+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF040K09+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF026B13+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN025F02+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN039J07+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS061H06+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN009A17+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN040E14+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN044B12+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS153G04+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS147C06+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN018M03+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN039M20+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS068A06+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN033M02+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN042D05+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN043P14+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGATTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN035H11+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN044E15+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS123G07+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS006H10+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF042N21+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN010B11+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS038H05+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN025O16+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS049G09+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN028M13+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN011P10+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN038I23+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN032F08+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN029I08+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS068G05+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN011B06+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN043N03+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF035F11+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF032D03+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF047E03+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF049P03+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF038G07+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF032E18+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF031J19+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF029F10+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF023F18+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF035K10+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF034F13+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF025B24+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF024O05+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF036K11+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN043E18+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF018M15+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF035H06+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF015H20+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF036F11+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF032B22+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF033A14+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF028I21+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF039L15+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF048D10+ ACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFN019O24+ CGTGGCCACCGGAGATGTTGGCGCC
JMFF006M12+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMSF013L16+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF024J08+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFS169F02+ CCAACAAAGGCGCCGAAAGTGACGTC-GGGGTTTACGTGGCCACCGGAGATGTTGGCGCA
JMSF017B20+ C
JMFF022J08+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF037L10+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF030A14+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCC-CCGGAGATGTTGGCGCC
JMFF020M17+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
JMFF038N23+ CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
                      ____________________________________________________________
consensus CCAACAAAGGCGCCGAAAGTGACGGC-GGGGTTGACGTGGCCACCGGAGATGTTGGCGCC
 
. : . : . : . : . : . :
JMFS017C04+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAG
rJMSF040K09- GACGGANACGGCA-ACGAAGAGGCCGANNGCGTGGGCAATGGAGGCGGAAATGA
JMSF045F21+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF043B21+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN014E08+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN006L17+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF050P16+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF029E11+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF040K09+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF026B13+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN025F02+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN039J07+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS061H06+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN009A17+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN040E14+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN044B12+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS153G04+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS147C06+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN018M03+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN039M20+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS068A06+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN033M02+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN042D05+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN043P14+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN035H11+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN044E15+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS123G07+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS006H10+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF042N21+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN010B11+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGAGAATGGAGGCGGAAATGAGGCCAG
JMFS038H05+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN025O16+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS049G09+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN028M13+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATAAGGCCAG
JMFN011P10+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN038I23+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN032F08+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN029I08+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS068G05+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN011B06+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN043N03+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF035F11+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF032D03+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF047E03+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF049P03+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF038G07+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF032E18+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF031J19+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF029F10+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF023F18+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF035K10+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF034F13+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF025B24+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF024O05+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF036K11+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN043E18+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF018M15+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF035H06+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF015H20+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF036F11+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF032B22+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF033A14+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF028I21+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF039L15+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF048D10+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFN019O24+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF006M12+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF013L16+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF024J08+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFS169F02+ GCCGTAGACGGCATTCGAAGAGGCATAAGGCCTGGGCAATGGAGGCGGAAATGAGGCCAG
JMSF017B20+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF022J08+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF037L10+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF030A14+ GACGGNGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF020M17+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
JMFF038N23+ GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
                      ____________________________________________________________
consensus GACGGAGACGGCA-ACGAAGAGGCCGAAGGCGTGGGCAATGGAGGCGGAAATGAGGCCAG
 
. : . : . : . : . : . :
JMSF045F21+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF043B21+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN014E08+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN006L17+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF050P16+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF029E11+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF040K09+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF026B13+ C-GGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN025F02+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN039J07+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS061H06+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN009A17+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN040E14+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN044B12+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS153G04+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS147C06+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN018M03+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN039M20+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS068A06+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN033M02+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN042D05+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN043P14+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN035H11+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN044E15+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS123G07+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS006H10+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF042N21+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN010B11+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS038H05+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN025O16+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS049G09+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN028M13+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN011P10+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN038I23+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN032F08+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN029I08+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS068G05+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN011B06+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN043N03+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF035F11+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF032D03+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF047E03+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF049P03+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF038G07+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF032E18+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF031J19+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF029F10+ CGGGGGTACTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF023F18+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF035K10+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF034F13+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF025B24+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF024O05+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF036K11+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN043E18+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF018M15+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF035H06+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF015H20+ CGGGGGTACTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF036F11+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF032B22+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF033A14+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF028I21+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF039L15+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF048D10+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFN019O24+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF006M12+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF013L16+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF024J08+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFS169F02+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMSF017B20+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF022J08+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF037L10+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF030A14+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF020M17+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
JMFF038N23+ CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
                      ____________________________________________________________
consensus CGGGGGTGCTAGCACCGTCGCCGGTCAACTTACTGTAAGCCACGCCGGAGCCCTGCCCGG
 
. : . : . : . : . : . :
JMSF045F21+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF043B21+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN014E08+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN006L17+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF050P16+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF029E11+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF040K09+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF026B13+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN025F02+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN039J07+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS061H06+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN009A17+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN040E14+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN044B12+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS153G04+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS147C06+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN018M03+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN039M20+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS068A06+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN033M02+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN042D05+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN043P14+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN035H11+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN044E15+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS123G07+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS006H10+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF042N21+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN010B11+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS038H05+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN025O16+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS049G09+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN028M13+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN011P10+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN038I23+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN032F08+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN029I08+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS068G05+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN011B06+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN043N03+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF035F11+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF032D03+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF047E03+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF049P03+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF038G07+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF032E18+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF031J19+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF029F10+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF023F18+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF035K10+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF034F13+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF025B24+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF024O05+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF036K11+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN043E18+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF018M15+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF035H06+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF015H20+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF036F11+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF032B22+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF033A14+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF028I21+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF039L15+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF048D10+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFN019O24+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF006M12+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF013L16+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF024J08+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFS169F02+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMSF017B20+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF022J08+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF037L10+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF030A14+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF020M17+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
JMFF038N23+ CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
                      ____________________________________________________________
consensus CAAACACAAAAATGAGTGTGCAGATGAACTCCGCCAGGGCGGCCTTCAGGCTGCCTGGGT
 
. : . : . : . : . : . :
JMSF045F21+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF043B21+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN014E08+ GGCGCAGCTCCTCATGGCTGCCTAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN006L17+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF050P16+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF029E11+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF040K09+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF026B13+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN025F02+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN039J07+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS061H06+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN009A17+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN040E14+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN044B12+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS153G04+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS147C06+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN018M03+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN039M20+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS068A06+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN033M02+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN042D05+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN043P14+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACCTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN035H11+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN044E15+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS123G07+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS006H10+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF042N21+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN010B11+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS038H05+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN025O16+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS049G09+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN028M13+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAA
JMFN011P10+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN038I23+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN032F08+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN029I08+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS068G05+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN011B06+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN043N03+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF035F11+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF032D03+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF047E03+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF049P03+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF038G07+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF032E18+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF031J19+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF029F10+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF023F18+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF035K10+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF034F13+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF025B24+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF024O05+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF036K11+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN043E18+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF018M15+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF035H06+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF015H20+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF036F11+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF032B22+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF033A14+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF028I21+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF039L15+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF048D10+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFN019O24+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF006M12+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF013L16+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF024J08+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFS169F02+ GGCGCAGCTCCTCATGGCTGCCCAGTGTTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMSF017B20+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF022J08+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF037L10+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF030A14+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF020M17+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
JMFF038N23+ GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
                      ____________________________________________________________
consensus GGCGCAGCTCCTCATGGCTGCCCAGTGCTACTTGGCGGATCGGCATCGCCGGAAAATCAA
 
. : . : . : . : . : . :
JMSF045F21+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGA
JMFF043B21+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATTCGAT
JMFN014E08+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTA
JMFN006L17+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAA
JMFF050P16+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAT
JMSF029E11+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMSF040K09+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMSF026B13+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACC
JMFN025F02+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTA
JMFN039J07+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGT
JMFS061H06+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGA
JMFN009A17+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFN040E14+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFN044B12+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFS153G04+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAA
JMFS147C06+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGA
JMFN018M03+ GAAAAGGTTAGAGAAAATGGGCGGAGC
JMFN039M20+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATT
JMFS068A06+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFN033M02+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAG
JMFN042D05+ GAAAAGGTTAGAGAAAAT
JMFN043P14+ GAAAAGGTTAG
JMFN035H11+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAAT
JMFN044E15+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFS123G07+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAAT
JMFS006H10+ GAAAAGGTTAGAGAAAATG
JMFF042N21+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTT
JMFN010B11+ GAAAAG
JMFS038H05+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAAT
JMFN025O16+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAAT
JMFS049G09+ GAAAAGGTTAGAGAAAA
JMFN011P10+ GA
JMFN038I23+ GAAAA
JMFN032F08+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGT
JMFN029I08+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAAT
JMFS068G05+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFN011B06+ GAAAAGGTTAGAGAAAATGGGC
JMFN043N03+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFF035F11+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATTCGAT
JMSF032D03+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMSF047E03+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMFF049P03+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGGTAACCTT
JMSF038G07+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAT
JMFF032E18+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGACAACC
JMFF031J19+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACC
JMFF029F10+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAAAACC
JMFF023F18+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACC
JMFF035K10+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMFF034F13+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAT
JMFF025B24+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCC
JMFF024O05+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATC
JMFF036K11+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAT
JMFN043E18+ GA
JMFF018M15+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAT
JMFF035H06+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAAC
JMFF015H20+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAAAACC
JMFF036F11+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMFF032B22+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMFF033A14+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATC
JMFF028I21+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACC
JMFF039L15+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCTT
JMFF048D10+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATG
JMFN019O24+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGA
JMFF006M12+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAT
JMSF013L16+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGAT
JMFF024J08+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCT
JMFS169F02+ TAAAAGGTTAGAGAGAATGGACGGAGCAAATTTA
JMSF017B20+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAAC
JMFF022J08+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACC
JMFF037L10+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCTT
JMFF030A14+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTGATCCGGTAACCT
JMFF020M17+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGGTAACCTT
JMFF038N23+ GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCTTC
                      ____________________________________________________________
consensus GAAAAGGTTAGAGAAAATGGGCGGAGCAAATTTAATTAGAGATGTTATCCGATAACCTTC