Previous Contig 001668:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003A23Sequence211001668 (31)gb:AB036735_15190431e-18Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.710001668 (31)gb:AB036735_15190432e-83Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF011D05Sequence581001668 (31)gb:AB036735_15190432e-76Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.758001668 (31)gb:AB036735_15190431e-97Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF012L05Sequence568001668 (31)gb:AB036735_15190433e-74Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.761001668 (31)gb:AB036735_15190433e-98Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF013I17Sequence545001668 (31)gb:AB036735_15190431e-73Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.784001668 (31)gb:AB036735_1519043e-103Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF020G07Sequence548001668 (31)gb:AB036735_15190432e-84Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.729001668 (31)gb:AB036735_15190434e-90Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF021O21Sequence162001668 (31)gb:AB036735_15190433e-09Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.727001668 (31)gb:AB036735_15190433e-87Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF024D19Sequence458001668 (31)gb:AB036735_15190437e-47Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.715001668 (31)gb:AB036735_15190432e-94Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF027H10Sequence592001668 (31)gb:AB036735_15190433e-81Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.752001668 (31)gb:AB036735_15190432e-98Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF038L16Sequence462001668 (31)gb:AB036735_15190436e-54Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.742001668 (31)gb:AB036735_15190435e-93Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF038N13Sequence565001668 (31)gb:AB036735_15190435e-77Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.231001668 (31)gb:OSJN00052_16939417e-07Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0067K08, complete seque
JMFF038N21Sequence520001668 (31)gb:AB036735_15190438e-66Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.634001668 (31)gb:AB036735_15190434e-70Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF040A09Sequence481001668 (31)gb:AB036735_15190435e-62Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.732001668 (31)gb:AB036735_15190433e-87Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFF051C14Sequence586001668 (31)gb:AB036735_15190433e-80Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.470001668 (31)gb:AB036735_15190434e-25Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMFS110F04Sequence409001668 (31)gb:AB036735_15190432e-33Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMSF011E10Sequence458001668 (31)gb:AB036735_15190431e-56Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.828001668 (31)gb:AB036735_1519043e-113Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.
JMSF026G14Sequence660001668 (31)gb:AB036735_15190432e-95Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.803001668 (31)gb:AB036735_1519043e-103Nicotiana tabacum NtADH mRNA for allyl alcohol dehydrogenase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051C14- GGGCAATTTAAATTGAGAATTAATTATGACAACAAAAACAGAGGTGAA
                      ____________________________________________________________
consensus GGGCAATTTAAATTGAGAATTAATTATGACAACAAAAACAGAGGTGAA
 
. : . : . : . : . : . :
rJMFF051C14- AAGTCAGAGATATAATTAGGCAAAACTAAAAGAGTAGAACTAAATGCAACAATGCAATAA
                      ____________________________________________________________
consensus AAGTCAGAGATATAATTAGGCAAAACTAAAAGAGTAGAACTAAATGCAACAATGCAATAA
 
. : . : . : . : . : . :
rJMFF051C14- TAATAGAGGATTAAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF038N21- TTAAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF038N13- TATTTATTATGAAGGTGGATCTGCTGAAC
JMFS110F04+ AAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF003A23- ATAGAGGATTAAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF040A09- ATAGAGGATTAAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF021O21- ATAGAGGATTAAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF038L16- TAAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF020G07- TATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF011D05- TATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF012L05- AATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF027H10- ATTTATTATGAAGGTGGATCTGCTGAAC
rJMSF026G14- AATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
rJMFF013I17- TTATGAAGG-TGGTCTGCTGAAC
rJMSF011E10- GGATCTGCTGAAC
                      ____________________________________________________________
consensus TAATAGAGGATTAAAAGTGAAATTTGCTCCATATTTATTATGAAGGTGGATCTGCTGAAC
 
. : . : . : . : . : . :
rJMFF051C14- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF038N21- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF038N13- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
JMFS110F04+ AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF003A23- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF040A09- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF021O21- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF038L16- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF020G07- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF011D05- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF012L05- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF027H10- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMSF026G14- AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMFF013I17- -AAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
rJMSF011E10- -AAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
                      ____________________________________________________________
consensus AAAGCAAGATTATATATATCACAGCATACCCATCTCAAGCGCTTTATTTAGAAAGCCAAG
 
. : . : . : . : . : . :
rJMFF051C14- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF038N21- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF038N13- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
JMFS110F04+ CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF003A23- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF040A09- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF021O21- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF038L16- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF020G07- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF024D19- TCATGTGAAATGGCCACCAACTGCTTCC
rJMFF011D05- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF012L05- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF027H10- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMSF026G14- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMFF013I17- CAGAGAAGAACACACATACATAAA-ACACTATTCATGTGAAATGGCCACCAACTGCTTCC
rJMSF011E10- CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
                      ____________________________________________________________
consensus CAGAGAAGAACACACATACATAAACACACTATTCATGTGAAATGGCCACCAACTGCTTCC
 
. : . : . : . : . : . :
rJMFF051C14- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF038N21- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF038N13- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
JMFS110F04+ CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF003A23- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF040A09- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF021O21- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF038L16- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
JMFF020G07+ CCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF020G07- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF024D19- CAACATTGTGACCAGAGAAAAGGCCGATCAAAGCAGCAGGAGCAGCTTCAAGCCCCTCAG
rJMFF011D05- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF012L05- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF027H10- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMSF026G14- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMFF013I17- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
rJMSF011E10- CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
                      ____________________________________________________________
consensus CAACATTCCGACCAGAGAAGAGCCCAATCAAAGCAGCCGGAGCACTTTCAAGTCCCTCAG
 
. : . : . : . : . : . :
rJMFF051C14- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF038N21- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF038N13- CTACATTCCTCAACATATGTAA
JMFS110F04+ CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF003A23- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF040A09- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF021O21- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF038L16- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
JMFF020G07+ CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF020G07- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF024D19- CTACA-TCCTCTACGTATGTAACCTTGCCTTCCTTTATCAATGGCAGCATCATCTCCAAA
rJMFF011D05- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF012L05- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF027H10- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMSF026G14- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMFF013I17- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
rJMSF011E10- CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
                      ____________________________________________________________
consensus CTACA-TCCTCAACATATGTAACCTTGCCTTCCTTAATGCATGGTAGTATCATCTCCAGA
 
. : . : . : . : . : . :
rJMFF051C14- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF038N21- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
JMFS110F04+ TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF003A23- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF040A09- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF021O21- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF038L16- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
JMFF020G07+ TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF020G07- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF024D19- TATTTCGGGTAGAGATGGTAGTAATCGCTTACCAGAAATCCTTCCATGCGAATTTGTTTT
rJMFF011D05- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF012L05- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF027H10- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMSF026G14- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMFF013I17- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
rJMSF011E10- TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
                      ____________________________________________________________
consensus TATTTTGGATACAGATGGTAGTGGTCAGCTACAATAAATCCTTCCATGCGAATCCGTTTT
 
. : . : . : . : . : . :
rJMFF051C14- GCG
rJMFF038N21- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
JMFS110F04+ GCGATAATAGAGGTTAAGTTGTGAACACCTTTTGGTTTTTCAAGATTGTATTGTGAGATC
rJMFF003A23- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMFF040A09- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMFF021O21- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMFF038L16- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
JMFF020G07+ GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTCTCAAGATTGTATTGTGAGATC
rJMFF020G07- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTCTCAAGATTGTATTGTGAGATC
rJMFF024D19- GAGATAAGGCAGAATAAGTTGTGAACGCCTTCATGTTTTTCCAGATTGTACTGCGAGATC
rJMFF011D05- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMFF012L05- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMFF027H10- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMSF026G14- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMFF013I17- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
rJMSF011E10- GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
                      ____________________________________________________________
consensus GCGATAATAGAGGTTAAGTTGTGAACACCTTCTGGTTTTTCAAGATTGTATTGTGAGATC
 
. : . : . : . : . : . :
rJMFF038N21- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCANAAGCACTGCGTCCAGCATC
JMFS110F04+ AT
rJMFF003A23- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF040A09- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF021O21- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF038L16- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
JMFF020G07+ ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF020G07- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF024D19- ATTCCACACACAATGATGCACCCCTTGAGGTTCATGTTCAGCAGCACTGCATCCAACATC
rJMFF011D05- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF012L05- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF027H10- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMSF026G14- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMFF013I17- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
rJMSF011E10- ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
                      ____________________________________________________________
consensus ATTCCACACACAGCAATGCGCCCTCGGAGGTTCATGTTCAGAAGCACTGCGTCCAGCATC
 
. : . : . : . : . : . :
rJMFF038N21- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTANGAAAACACCTTTTCAAGGCT
rJMFF003A23- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF040A09- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF021O21- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF038L16- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
JMFF020G07+ TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF020G07- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF024D19- TTTCCCCCCACATTTTCAAAGTACAAATCAATTCCCTTAGGGAAGTACCTTTTCAAGGCT
rJMFF011D05- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF012L05- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF027H10- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMSF026G14- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMFF013I17- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
rJMSF011E10- TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
                      ____________________________________________________________
consensus TTACCCCCCACATTCTCGAAGTAAATATCAATTCCATTAGGAAAACACCTTTTCAAGGCT
 
. : . : . : . : . : . :
rJMFF038N21- GCATTCAAGTCCTGCTCCTCTTTGTANTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF003A23- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF040A09- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF021O21- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF038L16- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
JMFF020G07+ GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF020G07- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF024D19- GCATCCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCTTCATCAAACCCAAATTTATTCTTC
rJMFF011D05- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF012L05- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF027H10- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMSF026G14- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMFF013I17- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
rJMSF011E10- GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
JMSF026G14+ GTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
                      ____________________________________________________________
consensus GCATTCAAGTCCTGCTCCTCTTTGTAGTTAAAAGCCTCATCAAACCCAAATTTATTCTTC
 
. : . : . : . : . : . :
rJMFF038N21- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAAC
rJMFF003A23- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF040A09- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF021O21- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF038L16- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
JMFF020G07+ AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF020G07- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF024D19- AGCAGATCAACCTTTTGTTTGGTACCAGCACTACCAACAACATAGCAACCGAAAAGCTTA
rJMFF011D05- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF012L05- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF027H10- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMSF026G14- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMFF013I17- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
rJMSF011E10- AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
JMSF026G14+ AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
JMFF051C14+ ATAGCAACCAAAAAGCTTT
JMFF027H10+ AACATAGCANCCAAAAAGCTTT
                      ____________________________________________________________
consensus AGCAGATCAACCTTCTCTTTGCTTCCAGCGCTACCAACAACATAGCAACCAAAAAGCTTT
 
. : . : . : . : . : . :
rJMFF003A23- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAA
rJMFF040A09- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMFF021O21- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMFF038L16- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMFF020G07+ GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMFF020G07- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMFF024D19- GCAAATTGTCCGACAAGCTGACCGACAGCACCAGATGCAGCTGAAACAAACACTGAATCT
rJMFF011D05- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMFF012L05- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMFF027H10- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMSF026G14- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMFF013I17- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
rJMSF011E10- GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMSF026G14+ GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMFF051C14+ GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMFF038N13+ TTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMFF027H10+ GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMFF012L05+ ACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMFF013I17+ CCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
JMFF011D05+ GTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
                      ____________________________________________________________
consensus GCTAATTGTCCAACAAGCTGACCAACAGCACCAGATGCTGCTGAAACATAGACAGTATCT
 
. : . : . : . : . : . :
rJMFF040A09- CCTTTCTTG
rJMFF021O21- CCTTTCTTGG
rJMFF038L16- CCTTTCTTGGGAGAACATACCTCATGAAATCCAG
JMFF020G07+ CCTTTCTTGGGAGAACATAC
rJMFF020G07- CCTTTCTTGGGAGAACATACC
rJMFF024D19- CCTTTCTTGGGAGAACACAGTTCATATAATCCAACATAAGCAGTCAT
rJMFF011D05- CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
rJMFF012L05- CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
rJMFF027H10- CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
rJMSF026G14- CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
rJMFF013I17- CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
rJMSF011E10- CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMSF026G14+ CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMFF051C14+ CCTTTCTGNGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMFF038N13+ CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMFF027H10+ CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMFF012L05+ CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMFF013I17+ CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMFF038N21+ TTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMFF040A09+ GAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
JMSF011E10+ ATACCA
JMFF011D05+ CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
                      ____________________________________________________________
consensus CCTTTCTTGGGAGAACATACCTCATGAAATCCAGCATAAGCAGTCATCCCAGCCATACCA
 
. : . : . : . : . : . :
rJMFF011D05- A
rJMFF012L05- AG
rJMFF027H10- AGGAG
rJMSF026G14- NGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTNCGAC
rJMFF013I17- AGGAGCCCAGTGTAGTAAGAAAGANGCACATCTGTATGTTCGACT
rJMSF011E10- AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMSF026G14+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF051C14+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF038N13+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF027H10+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF012L05+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF013I17+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF038N21+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF040A09+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMSF011E10+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF011D05+ AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
JMFF038L16+ GTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
                      ____________________________________________________________
consensus AGGAGCCCAGTGTAGTAAGAAAGAGGCACATCTGTATGTTCGACTTTAAAGAGAGCCTGC
 
. : . : . : . : . : . :
rJMSF011E10- GTAGCAGTGATAANGCTGTACTCCTCCCATCCAGTCA
JMSF026G14+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF051C14+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF038N13+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF027H10+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF012L05+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF013I17+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF038N21+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF040A09+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMSF011E10+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF024D19+ GTAGCGGTGATAATGGTGTACTCCTCCCATCCGGTCATTCCCGCAACCAAATCACCTTTC
JMFF011D05+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
JMFF038L16+ GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
                      ____________________________________________________________
consensus GTAGCAGTGATAATGCTGTACTCCTCCCATCCAGTCACTCCCCAAACCAAGTCACCTTTC
 
. : . : . : . : . : . :
JMSF026G14+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF051C14+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF038N13+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF027H10+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF012L05+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF013I17+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF038N21+ TTGAAGTTGGGAAGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF040A09+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMSF011E10+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF024D19+ TTGAAATTTGGATTATCAGAATCCACGACTTTAGCAACACCAATTCCGACAATGGGTTTT
JMFF011D05+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
JMFF038L16+ TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
                      ____________________________________________________________
consensus TTGAAGTTGGGATGATCAGAATCCAGGACTTTAGCAACTCCATATCCAACAATAGGCGAT
 
. : . : . : . : . : . :
JMSF026G14+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF051C14+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF038N13+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF027H10+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF012L05+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF013I17+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF038N21+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF040A09+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMSF011E10+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF024D19+ CCTGGAGTGAAAGAGTCGATATAGGTGCCGTGGGGTTTGGTCATGCTCATGCGACCACGC
JMFF011D05+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
JMFF038L16+ CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
                      ____________________________________________________________
consensus CCAGGAGTGAAAGAGTCGACATAGCTGCCATGGGGTT------TGTTCATGCGACCACGC
 
. : . : . : . : . : . :
JMSF026G14+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF051C14+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF038N13+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF027H10+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF012L05+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF013I17+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF038N21+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF040A09+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMSF011E10+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF003A23+ TGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF021O21+ TGTGGA
JMFF024D19+ ATGTAGGGGTCGCAGGAAAGGTAAAGGTTCTTCACAACAACGGCGCCGGAACCTTGTGGA
JMFF011D05+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
JMFF038L16+ ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
                      ____________________________________________________________
consensus ATGTAGGGGTCGCAAGAAAGATAGAGGTTCTTAAGAAGAACGGCGTTGGAACCTTGTGGA
 
. : . : . : . : . : . :
JMSF026G14+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF051C14+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF038N13+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF027H10+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF012L05+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF013I17+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF038N21+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF040A09+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMSF011E10+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF003A23+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF021O21+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF024D19+ ACCTCAAGCTTCACACTAGTGGTTCGGATTTCCAAGTCGGAGTCTTTGGGAGATCCGGTG
JMFF011D05+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
JMFF038L16+ ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
                      ____________________________________________________________
consensus ACCTCCAGCTTCAGAGTGGTGGTACGGATTTCCATGTCGGACTCTTTGGGATATCCGGTG
 
. : . : . : . : . : . :
JMSF026G14+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF051C14+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF038N13+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF027H10+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF012L05+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF013I17+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF038N21+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF040A09+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMSF011E10+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF003A23+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF021O21+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF024D19+ ACGTAGTGTTTCAGTATCACCTGCTTGTTGCTCACCTCCTCCATATCCATTT
JMFF011D05+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
JMFF038L16+ ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
                      ____________________________________________________________
consensus ACGTAGTCTTTTAGTACTATCTGCTTGTTGCTCACTTCCTCCATAGCCATTTCTCCCTCT
 
. : . : . : . : . : . :
JMSF026G14+ CGATGCTGTTGTCTGTCTGAA-CAGT
JMFF051C14+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGT
JMFF038N13+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACT
JMFF027H10+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACT
JMFF012L05+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACTGTGGAAGTCTGTC
JMFF013I17+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGT
JMFF038N21+ NGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACTGTGGAAGTCTGTC
JMFF040A09+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGT
JMSF011E10+ CGATGCTGTTGTCTGTCTGAACCAGTGAACAGTGACT
JMFF003A23+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGT
JMFF021O21+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACT
JMFF011D05+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACTGTGGAAGTCTGTC
JMFF038L16+ CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACTGTGGAAGTCTGTCCCTGTGATAT
                      ____________________________________________________________
consensus CGATGCTGTTGTCTGTCTGAA-CAGTGAACAGTGACTGTGGAAGTCTGTCCCTGTGATAT