Previous Contig 001667:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038L14Sequence474001667 (3)715010011 (3)gb:OSJN00025_16935042e-23Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02, complete seque
JMFF047D02Sequence610001667 (3)gb:AF515697_18074782e-37Arabidopsis thaliana cleavage stimulation factor 77 mRNA, complete cds.
JMFS028D05Sequence651001667 (3)gb:AF515697_18074786e-49Arabidopsis thaliana cleavage stimulation factor 77 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS028D05+ TAAGAATGCAATGTACTCCATCCAAACAGGG
                      ____________________________________________________________
consensus TAAGAATGCAATGTACTCCATCCAAACAGGG
 
. : . : . : . : . : . :
JMFF047D02+ GCATGAACTCATAAGCTTTCCTAGTCTCT
JMFS028D05+ CCTGAGGCAATGTCTACTCCGACATAGTTAAGCATGAACTCATAAGCTTTCCTAGTCTCT
                      ____________________________________________________________
consensus CCTGAGGCAATGTCTACTCCGACATAGTTAAGCATGAACTCATAAGCTTTCCTAGTCTCT
 
. : . : . : . : . : . :
JMFF047D02+ TCCTGACCCTCAGCTCCCCTCTTATCATTTACCTTTCTGATAAAACGAATATAACAGCGC
JMFS028D05+ TCCTGACCCTCAGCTCCCCTCTTATCATTTACCTTTCTGATAAAACGAATATAACAGCGC
                      ____________________________________________________________
consensus TCCTGACCCTCAGCTCCCCTCTTATCATTTACCTTTCTGATAAAACGAATATAACAGCGC
 
. : . : . : . : . : . :
JMFF047D02+ CAAAGAGGAATTTGCAGACAGTTTAATAAACAACGACTAAAAATTTGCTTTGTGGCATCA
JMFS028D05+ CAAAGAGGAATTTGCAGACAGTTTAATAAACAACGACTAAAAATTTGCTTTGTGGCATCA
                      ____________________________________________________________
consensus CAAAGAGGAATTTGCAGACAGTTTAATAAACAACGACTAAAAATTTGCTTTGTGGCATCA
 
. : . : . : . : . : . :
JMFF047D02+ TCATTATTTACAGCCATATGTGCCTCGACATACTGTTTCCAATATTTCGCAGCAGTAGGA
JMFS028D05+ TCATTATTTACAGCCATATGTGCCTCGACATACTGTTTCCAATATTTCGCAGCAGTAGGA
                      ____________________________________________________________
consensus TCATTATTTACAGCCATATGTGCCTCGACATACTGTTTCCAATATTTCGCAGCAGTAGGA
 
. : . : . : . : . : . :
JMFF047D02+ AAAGTAGACATCAGTTGCTCATATATAGGCACTGCCTCAGCAATTGGCAAACGCATTGCC
JMFS028D05+ AAAGTAGACATCAGTTGCTCATATATAGGCACTGCCTCAGCAATTGGCAAACGCATTGCC
                      ____________________________________________________________
consensus AAAGTAGACATCAGTTGCTCATATATAGGCACTGCCTCAGCAATTGGCAAACGCATTGCC
 
. : . : . : . : . : . :
JMFF047D02+ TCGTTGGCGACAATTTCTGCAGCTTCAACATTGTACTTACTGTCCGCCATTGTTGTACAA
JMFS028D05+ TCGTTGGCGACAATTTCTGCAGCTTCAACATTGTACTTACTGTCCGCCATTGTTGTACAA
                      ____________________________________________________________
consensus TCGTTGGCGACAATTTCTGCAGCTTCAACATTGTACTTACTGTCCGCCATTGTTGTACAA
 
. : . : . : . : . : . :
JMFF047D02+ GTATATGACTGACACCAGTCCAACTTACTGGGAAATTCTGAGAGGCTGAGATTGTGAGAC
JMFS028D05+ GTATATGACTGACACCAGTCCAACTTACTGGGAAATTCTGAGAGGCTGAGATTGTGAGAC
                      ____________________________________________________________
consensus GTATATGACTGACACCAGTCCAACTTACTGGGAAATTCTGAGAGGCTGAGATTGTGAGAC
 
. : . : . : . : . : . :
JMFF047D02+ ACTGACTCACTGAGGACTCCTGCTGGGCTGCTGACTGGCGAAATTAGGGC
JMFS028D05+ ACTGACTCACTGAGGACTCCTGCTGGGCTGCTGACTGGCGAAATTAGGGCACAGAGGAAT
JMFF038L14+ TGAGGACTCCTGCTGGGCTGCTGACTGGCGANATTATGGCACAGAGGAAT
                      ____________________________________________________________
consensus ACTGACTCACTGAGGACTCCTGCTGGGCTGCTGACTGGCGAAATTAGGGCACAGAGGAAT
 
. : . : . : . : . : . :
JMFS028D05+ GGCGAGTGGCGAGGTGCGACCGTTCGGCA-AAACAGGGACAGAGCGATAGAGC
JMFF038L14+ GGCGAGTGGCGAGGTGCGACCGTTCGGCACAGACAGGGATAGAGCGATAGAGCCACAGAT
                      ____________________________________________________________
consensus GGCGAGTGGCGAGGTGCGACCGTTCGGCACAGACAGGGATAGAGCGATAGAGCCACAGAT
 
. : . : . : . : . : . :
JMFF038L14+ GATCGAGGACTCCTGAGTCCTGAGAGGAGACGAGAGACCGAGAGGGACAGTAGCCGGTAC
                      ____________________________________________________________
consensus GATCGAGGACTCCTGAGTCCTGAGAGGAGACGAGAGACCGAGAGGGACAGTAGCCGGTAC
 
. : . : . : . : . : . :
JMFF038L14+ TCCGGTGGTAGCGAGAGGCGAGAGGCAGAGAGGCGGTCAGGCTGAGAGTAAGAGAGACGC
                      ____________________________________________________________
consensus TCCGGTGGTAGCGAGAGGCGAGAGGCAGAGAGGCGGTCAGGCTGAGAGTAAGAGAGACGC