Previous Contig 001663:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025H17Sequence176001663 (23)149001663 (23)
JMFF035G11Sequence519001663 (23)sp|Q9ATF5|RL1X_CASSA6e-7660S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei680001663 (23)sp|P51418|RL1X_ARATH7e-7860S ribosomal protein L18a-1.>pir|T02335|T02335 ribosomal protein L18a, cytosoli
JMFF038I16Sequence428001663 (23)sp|Q9ATF5|RL1X_CASSA5e-5960S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei657001663 (23)sp|P51418|RL1X_ARATH4e-6660S ribosomal protein L18a-1.>pir|T02335|T02335 ribosomal protein L18a, cytosoli
JMFF045G11Sequence581001663 (23)sp|Q9ATF5|RL1X_CASSA4e-8660S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei553001663 (23)sp|P51418|RL1X_ARATH1e-4860S ribosomal protein L18a-1.>pir|T02335|T02335 ribosomal protein L18a, cytosoli
JMFN002D02Sequence455001663 (23)sp|Q9ATF5|RL1X_CASSA2e-6960S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMFN007E04Sequence612001663 (23)sp|Q9ATF5|RL1X_CASSA7e-9260S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMFN015B16Sequence610001663 (23)sp|Q9ATF5|RL1X_CASSA1e-9260S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMFN018I08Sequence606001663 (23)sp|Q9ATF5|RL1X_CASSA1e-9260S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMFN033P04Sequence609001663 (23)sp|Q9ATF5|RL1X_CASSA5e-9260S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMFN042P23Sequence173001663 (23)sp|Q9ATF5|RL1X_CASSA2e-1660S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMSF004E01Sequence428001663 (23)sp|Q9ATF5|RL1X_CASSA1e-5960S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMSF007J14Sequence432001663 (23)sp|Q9ATF5|RL1X_CASSA3e-6060S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei661001663 (23)sp|Q9ATF5|RL1X_CASSA3e-9160S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMSF026J22Sequence662001663 (23)sp|Q9ATF5|RL1X_CASSA1e-8660S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMSF027C12Sequence682001663 (23)sp|Q9ATF5|RL1X_CASSA5e-8860S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei728009852 (10)gb:AY395689_16048172e-77Solanum brevidens 60S ribosomal protein L13 (Ci-1) mRNA, partial cds.
JMSF037K05Sequence659001663 (23)sp|Q9ATF5|RL1X_CASSA2e-9260S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei692001663 (23)sp|Q9ATF5|RL1X_CASSA2e-9260S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei
JMSF045P18Sequence705001663 (23)sp|Q9ATF5|RL1X_CASSA9e-9260S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei623001663 (23)sp|Q9ATF5|RL1X_CASSA5e-9060S ribosomal protein L18a.>gb:AF334839_1787491 Castanea sativa ribosomal protei

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045G11- CTTTTTTTAGAACTCAAGAAAATATAATTCT
                      ____________________________________________________________
consensus CTTTTTTTAGAACTCAAGAAAATATAATTCT
 
. : . : . : . : . : . :
rJMFF025H17- TAGTTGTGATTATCAAACACATGTAGAAAGTAGCT
JMFF025H17+ TGAAGCATAAGCAATTCATAGTTGTGATTATCAAACACATGTAGAAAGTAGCT
rJMFF045G11- CAAAATATGAAGCATAAGCAATTCATAGTTGTGATTATCAAACACATGTAGAAAGTAGCT
rJMFF038I16- TGAAGCATAAGCAATTCATAGTTGTGATTATCGAACACATGTANAAAGTAGCT
rJMFF035G11- TGAAGCATAAGCAATTCATAGTTGTGATTATCAAACACATGTAGAAAGTAGCT
                      ____________________________________________________________
consensus CAAAATATGAAGCATAAGCAATTCATAGTTGTGATTATCAAACACATGTAGAAAGTAGCT
 
. : . : . : . : . : . :
rJMFF025H17- AAATATAGGTACCTTCATAGTAAAACTAGAAAATTTGATCAAAATAATGATAGAAGTTAA
JMFF025H17+ AAATATAGGTACCTTCATAGTAAAACTAGAAAATTTGATCAAAATAATGATAGAAGTTAA
rJMFF045G11- AAATATAGGTACCTTCATAGTAAAACTAGAAAATTTGATCAAAATAATGATAGAAGTTAA
rJMFF038I16- AAATATAGGTACCTTCATAGTAAAACTAGAAAATTTGATCNAAATAATGATAGAAGTTAA
rJMFF035G11- AAATATAGGTACCTTCATAGTAAAACTAGAAAATTTGATCAAAATAATGATAGAAGTTAA
rJMSF045P18- A
                      ____________________________________________________________
consensus AAATATAGGTACCTTCATAGTAAAACTAGAAAATTTGATCAAAATAATGATAGAAGTTAA
 
. : . : . : . : . : . :
rJMFF025H17- TCTCCCTTTTTCTTCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTG
JMFF025H17+ TCTCCCTTTTTCTTCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTG
rJMFF045G11- TCTCCCTTTTTCTTCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTGCAGAA
rJMFF038I16- TCTCCCTTTTTCTTCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTGCNNAA
rJMFF035G11- TCTCCCTTTTTCTTCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTGCAGAA
rJMSF045P18- TCTCCCTTTTTCTTCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTGCAGAA
rJMSF037K05- TCTTTCACTTAAACAGGGTCTAAAATTGCAGAA
JMSF045P18+ TCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTGCAGAA
JMSF027C12+ AAACA-GGTCTAAAATTGCAGAA
JMSF026J22+ CAGAA
                      ____________________________________________________________
consensus TCTCCCTTTTTCTTCTCCAGATAACAATCTTTCACTTAAACA-GGTCTAAAATTGCAGAA
 
. : . : . : . : . : . :
rJMFF045G11- CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
rJMFF038I16- CAAGGAAACTGGTAATGANACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
rJMFF035G11- CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
rJMSF045P18- CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
JMFN015B16+ AGTATTAGACCAACCAAGTTACACAAAGATGTTGGGC
JMFN018I08+ CAAGTTACACAAAGATGTTGGGC
JMFN007E04+ AGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
JMFN033P04+ CTGGTAATGAGACACAGTATT-GACCAAACAAGTTACACAAAGATGTGGGGC
rJMSF037K05- CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
JMSF045P18+ CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
JMSF037K05+ CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
rJMSF007J14- AAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
JMSF027C12+ CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
JMSF026J22+ CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
                      ____________________________________________________________
consensus CAAGGAAACTGGTAATGAGACACAGTATTAGACCAAACAAGTTACACAAAGATGTTGGGC
 
. : . : . : . : . : . :
rJMFF045G11- CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
rJMFF038I16- CTAGATGCCTTGNATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
rJMFF035G11- CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
rJMSF045P18- CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMFN015B16+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMFN018I08+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMFN007E04+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMFN033P04+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
rJMSF037K05- CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMSF045P18+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMSF037K05+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
rJMSF007J14- CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMSF027C12+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMSF026J22+ CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
JMFF045G11+ GTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
                      ____________________________________________________________
consensus CTAGATGCCTTGTATGTGGTCTTGAGCTTCCTGGATGGTGGCCTCACCTTCTTGAACACC
 
. : . : . : . : . : . :
rJMFF045G11- AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
rJMFF038I16- AACGGGAACTTGATCTTGGANTTGNGGAATTGCTTGGNGCTCTCCCTCTTGCANAGTTTT
rJMFF035G11- AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
rJMSF045P18- AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMFN015B16+ AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMFN018I08+ AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMFN007E04+ AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMFN033P04+ AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
rJMSF037K05- AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMSF045P18+ AACGGGAACTTGATCTNGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMSF037K05+ AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
rJMSF007J14- AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMSF027C12+ AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMSF026J22+ AACGGGAACTTGATCTNGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMFN002D02+ AGTTTT
JMFF035G11+ GTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
JMFF045G11+ AACGGGAACTTGATCTNGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
                      ____________________________________________________________
consensus AACGGGAACTTGATCTTGGAGTTGTGGAATTGCTTGGTGCTCTCCCTCTTGCAGAGTTTT
 
. : . : . : . : . : . :
rJMFF045G11- GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
rJMFF038I16- GCTGGGATGGTGGCTGNCTTGATGATTTGGATGCAGTGGNGGCGCACCCTGTGACGANAA
rJMFF035G11- GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
rJMSF045P18- GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMFN015B16+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMFN018I08+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMFN007E04+ GCTGGGATGGTGGCTGTCTTGATAATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMFN033P04+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
rJMSF037K05- GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMSF045P18+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMSF037K05+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
rJMSF007J14- GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMSF027C12+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMSF026J22+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMFN002D02+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMSF007J14+ GTGACGAGAA
JMFF035G11+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMSF004E01+ TGACGAGAA
JMFF045G11+ GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
JMFF038I16+ TGACGAGAA
                      ____________________________________________________________
consensus GCTGGGATGGTGGCTGTCTTGATGATTTGGATGCAGTGGTGGCGCACCCTGTGACGAGAA
 
. : . : . : . : . : . :
rJMFF045G11- GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
rJMFF038I16- GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCNAGGTTGTGTCACGGAACTCCTTG
rJMFF035G11- GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
rJMSF045P18- GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFN015B16+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFN018I08+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFN007E04+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFN033P04+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
rJMSF037K05- GCCATCTCAGTGTACATCTGCTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMSF045P18+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMSF037K05+ GCCATCTCAGTGTACATCTGCTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
rJMSF007J14- GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMSF027C12+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMSF026J22+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFN002D02+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMSF007J14+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFF035G11+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMSF004E01+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFF045G11+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
JMFF038I16+ GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
                      ____________________________________________________________
consensus GCCATCTCAGTGTACATCTGTTCAACAGCGCCATTCAAGGTTGTGTCACGGAACTCCTTG
 
. : . : . : . : . : . :
rJMFF045G11- TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATA
rJMFF038I16- TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGNAATTCTTAACC
rJMFF035G11- TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
rJMSF045P18- TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFN015B16+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFN018I08+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFN007E04+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFN033P04+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
rJMSF037K05- TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMSF045P18+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMSF037K05+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
rJMSF007J14- TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMSF027C12+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMSF026J22+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFN002D02+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMSF007J14+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFF035G11+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMSF004E01+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFF045G11+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
JMFF038I16+ TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
                      ____________________________________________________________
consensus TACATATTGTGATACCCGGTTCTGCTCTGGTACCTCAACCATATCCCGTAATTCTTAACC
 
. : . : . : . : . : . :
rJMFF038I16- TTGGTAGGGCACTTCTCAAATATCTCATTGATANCGAGGACCTGGCCATTGCTTTTCTTA
rJMFF035G11- TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
rJMSF045P18- TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFN015B16+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFN018I08+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFN007E04+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFN033P04+ TTGGTAGGGCACTTCTCAAATATCTCATTGATGGCGAGGACCTGGCCATTGCTTTTCTTA
rJMSF037K05- TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMSF045P18+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMSF037K05+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
rJMSF007J14- TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMSF027C12+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMSF026J22+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFN002D02+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMSF007J14+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFF035G11+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMSF004E01+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFF045G11+ TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
JMFF038I16+ NTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
                      ____________________________________________________________
consensus TTGGTAGGGCACTTCTCAAATATCTCATTGATAGCGAGGACCTGGCCATTGCTTTTCTTA
 
. : . : . : . : . : . :
rJMFF038I16- ACTTTCTTCAGCTTCCTC-NAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGG
rJMFF035G11- ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
rJMSF045P18- ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFN015B16+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFN018I08+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFN007E04+ ACTTTCTTCAGCTTCCTC-AAAAGATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFN033P04+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
rJMSF037K05- ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMSF045P18+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMSF037K05+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
rJMSF007J14- ACTCTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMSF027C12+ ACTTTCTTCAGCTTCCTCAAAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMSF026J22+ ACTT--TTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFN002D02+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMSF007J14+ ACTCTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFN042P23+ TGGACTTGGCACGGACCTCATTGGT
JMFF035G11+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMSF004E01+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFF045G11+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
JMFF038I16+ ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
                      ____________________________________________________________
consensus ACTTTCTTCAGCTTCCTC-AAAAAATACCAGAACTTGGACTTGGCACGGACCTCATTGGT
 
. : . : . : . : . : . :
rJMFF035G11- TGCCCAGAGCTTCATGCGGTAGA
rJMSF045P18- TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFN015B16+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFN018I08+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFN007E04+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFN033P04+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
rJMSF037K05- TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMSF045P18+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMSF037K05+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
rJMSF007J14- TGCCCAGAGCTTCATGCGGNAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMSF027C12+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMSF026J22+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFN002D02+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMSF007J14+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFN042P23+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFF035G11+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMSF004E01+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFF045G11+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
JMFF038I16+ TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
                      ____________________________________________________________
consensus TGCCCAGAGCTTCATGCGGTAGATCTTGGGGTGCTCATCGGTCTCCGACGGGAGCGCTCT
 
. : . : . : . : . : . :
rJMSF045P18- TCCGACAACCTGGTACTGATGGAA
JMFN015B16+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFN018I08+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFN007E04+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFN033P04+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
rJMSF037K05- TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMSF045P18+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMSF037K05+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
rJMSF007J14- TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMSF027C12+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMSF026J22+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFN002D02+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMSF007J14+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFN042P23+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFF035G11+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMSF004E01+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFF045G11+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
JMFF038I16+ TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
                      ____________________________________________________________
consensus TCCGACAACCTGGTACTGATGGAATCTGTAGGTCACCATTTTCGCAACGACGGAGCCGTC
 
. : . : . : . : . : . :
JMFN015B16+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTC
JMFN018I08+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTG
JMFN007E04+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTC
JMFN033P04+ TTCCTGAGATCCTCTCTCC
rJMSF037K05- TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAANCTAGG
JMSF045P18+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGG
JMSF037K05+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGG
rJMSF007J14- TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAACTAGGTC
JMSF027C12+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTCC
JMSF026J22+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTCC
JMFN002D02+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTC
JMSF007J14+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTC
JMFN042P23+ TTCCTGAGATCCTCTCTCCCTCCCTCTC
JMFF035G11+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTC
JMSF004E01+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTCC
JMFF045G11+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTCC
JMFF038I16+ TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTCC
                      ____________________________________________________________
consensus TTCCTGAGATCCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTGTGCAGCTAAGCTAGGTCC