Previous Contig 001661:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007J06Sequence603001661 (7)gb:AC136217_17430176e-29Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0030I14, complet778001661 (7)gb:AY088130_15731535e-30Arabidopsis thaliana clone 41557 mRNA, complete sequence.
JMFF020H02Sequence586001661 (7)gb:AC136217_17430177e-24Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0030I14, complet
JMFF031N04Sequence591001661 (7)gb:AC136217_17430171e-20Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0030I14, complet761001661 (7)pir|T02891|T028917e-25hypothetical protein T13J8.10 - Arabidopsis thaliana>gb:ATCHRIV68_1546670 Arabid
JMFF038I02Sequence473001661 (7)gb:AY099753_15767781e-19Arabidopsis thaliana putative protein (At5g53420) mRNA, complete cds.>gb:BT00028713001661 (7)gb:AY088130_15731539e-29Arabidopsis thaliana clone 41557 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF031N04- CTGCTTTATCATATT
rJMFF007J06- CTTTATCATATT
                      ____________________________________________________________
consensus CTGCTTTATCATATT
 
. : . : . : . : . : . :
rJMFF031N04- CATCAACAAACACTAATACACTATATGTACAGCCCTAGTTTGGATTACGCTTCTACTAAG
rJMFF038I02- CTATATGTACAGCCCTAGTTTGGATTACGCTTCTACTAAG
rJMFF007J06- CATCAACAAACACTAATACACTATATGTACAGCCCTAGTTTGGATTACGCTTCTACTAAG
                      ____________________________________________________________
consensus CATCAACAAACACTAATACACTATATGTACAGCCCTAGTTTGGATTACGCTTCTACTAAG
 
. : . : . : . : . : . :
rJMFF031N04- ATCATTGCAGCTAATGAAAGAACAACAAACTTGCAGTTTTAAGGTCACGGTTTATAGAGC
rJMFF038I02- ATCATTGCAGCTAATGAAAGAACAACAAACTTGCAGTTTTAAGGTCACGGTTTATAGAGC
rJMFF007J06- ATCATTGCAGCTAATGAAAGAACAACAAACTTGCAGTTTTAAGGTCACGGTTTATAGAGC
                      ____________________________________________________________
consensus ATCATTGCAGCTAATGAAAGAACAACAAACTTGCAGTTTTAAGGTCACGGTTTATAGAGC
 
. : . : . : . : . : . :
rJMFF031N04- AGATACCGCGTAAAGCTTAGCTTCTTCTTCTTTTTGCGTTGTACTTGTCTGTATCGCAAG
rJMFF038I02- AGATACCGCGTAAAGCTTAGCTTCTTCTTCTTTTTGCGTTGTACTTGTCTGTATCGCAAG
rJMFF007J06- AGATACCGCGTAAAGCTTAGCTTCTTCTTCTTTTTGCGTTGTACTTGTCTGTATCGCAAG
                      ____________________________________________________________
consensus AGATACCGCGTAAAGCTTAGCTTCTTCTTCTTTTTGCGTTGTACTTGTCTGTATCGCAAG
 
. : . : . : . : . : . :
rJMFF031N04- ATTTCCTCGTTCCCTTGCTTCTGCAGCAGTAACTAATAATACCCTTTTTTACATTCTTCT
rJMFF038I02- ATTTCCTCGTTCCCTTGCTTCTGCAGCAGTAACTAATAATACCCTTTTTTACATTCTTCT
rJMFF007J06- ATTTCCTCGTTCCCTTGCTTCTGCAGCAGTAACTAATAATACCCTTTTTTACATTCTTCT
                      ____________________________________________________________
consensus ATTTCCTCGTTCCCTTGCTTCTGCAGCAGTAACTAATAATACCCTTTTTTACATTCTTCT
 
. : . : . : . : . : . :
rJMFF031N04- TGCTAGTAGAGAGACTCAAAACAGTCAATGCTTCTTGGATGATGCATCTGCTGCTTCTTC
rJMFF038I02- TGCTAGTAGAGAGACTCAAAACAGTCAATGCTTCTTGGATGATGCATCTGCTGCTTCTTC
rJMFF007J06- TGCTAGTAGAGAGACTCAAAACAGTCAATGCTTCTTGGATGATGCATCTGCTGCTTCTTC
                      ____________________________________________________________
consensus TGCTAGTAGAGAGACTCAAAACAGTCAATGCTTCTTGGATGATGCATCTGCTGCTTCTTC
 
. : . : . : . : . : . :
rJMFF031N04- TGTTCTCGCAAATCTTCCCCGGATCCTTGGCTGACTGTCAGCCAAGGCTTTCCTGCAAGC
rJMFF038I02- TGTTCTCGCAAATCTTCCCCGGATCCTTGGCTGACTGTCAGCCAAGGCTTTCCTGCAAGC
rJMFF007J06- TGTTCTCGCAAATCTTCCCCGGATCCTTGGCTGACTGTCAGCCAAGGCTTTCCTGCAAGC
                      ____________________________________________________________
consensus TGTTCTCGCAAATCTTCCCCGGATCCTTGGCTGACTGTCAGCCAAGGCTTTCCTGCAAGC
 
. : . : . : . : . : . :
rJMFF031N04- ATACTTGATTTTCCTGCCAAAGTTCCTTTTGTTCCTCTTGCTCCTGTATCGGGAAAGCTT
rJMFF038I02- ATACTTGATTTTCCTGCCAAAGTTCCTTTTGTTCCTCTTGCTCCTGTATCGGGAAAGCTT
rJMFF007J06- ATACTTGATTTTCCTGCCAAAGTTCCTTTTGTTCCTCTTGCTCCTGTATCGGGAAAGCTT
                      ____________________________________________________________
consensus ATACTTGATTTTCCTGCCAAAGTTCCTTTTGTTCCTCTTGCTCCTGTATCGGGAAAGCTT
 
. : . : . : . : . : . :
rJMFF031N04- CTCTTGTCGGTCTTCAGAAATGGCGCTGCTGATAATGGGCTGGTGTCCCTTTGGAGAGTG
rJMFF038I02- CTCTTGTCGGTCTTCAGAAATGGCGCTGCTGATAATGGGCTGGTGTCCCTTTGGAGAGTG
rJMFF007J06- CTCTTGTCGGTCTTCAGAAATGGCGCTGCTGATAATGGGCTGGTGTCCCTTTGGAGAGTG
JMFF007J06+ TTTGGAGAGTG
                      ____________________________________________________________
consensus CTCTTGTCGGTCTTCAGAAATGGCGCTGCTGATAATGGGCTGGTGTCCCTTTGGAGAGTG
 
. : . : . : . : . : . :
rJMFF031N04- GATGAGGCTCACGTTACCGTTGCCAAGAAGTCTTTATGTCGCCTTCACTGTATGACCTCC
rJMFF038I02- GATGAGGCTCACGTTACCGTTGCCAAG-AGTCTTTATGTCGCCTTCACTGTATGACCTCC
rJMFF007J06- GATGAGGCTCACGTTACCGTTGCCAAG-AGTCTTTATGTCGCCTTCACTGTATGACCTCC
JMFF007J06+ GATGAGGCTCACGTTACCGTTGCCAAG-AGTCTTTATGTCGCCTTCACTGTATGACCTCC
                      ____________________________________________________________
consensus GATGAGGCTCACGTTACCGTTGCCAAG-AGTCTTTATGTCGCCTTCACTGTATGACCTCC
 
. : . : . : . : . : . :
rJMFF031N04- TCATACCATAAACAGCGCCAAAGTCCATTCCGGGAAAAGCGAGAAAATTCGGCATCGTTG
rJMFF038I02- TCATACCATAAACAGCGCCAAAGTCCATTCCGGGAAAAGCGAGAAAATTCGGCATCGTTG
rJMFF007J06- TCATACCATAAACAGCGCCAAAGTCCATTCCGGGAAAAGCGAGAAAATTCGGCATCGTTG
JMFF007J06+ TCATACCATAAACAGCGCCAAAGTCCATTCCGGGAAAAGCGAGAAAATTCGGCATCGTTG
JMFF031N04+ CCATAAACAGCGCCAAAGTCCATTCCGGGAAAAGCGAGAAAATTCGGCATCGTTG
JMFF020H02+ AAACAGCGCCAAAGTCCATTCCGGGAAAAGCGAGAAAATTCGGCATCGTNG
                      ____________________________________________________________
consensus TCATACCATAAACAGCGCCAAAGTCCATTCCGGGAAAAGCGAGAAAATTCGGCATCGTTG
 
. : . : . : . : . : . :
rJMFF031N04- GAGGCGCCCCTTGAACCCACTCCATGGAGCTCAGAGACTCCGAGCTGCCACTTTTCTGAA
rJMFF038I02- GAGGCGCCCCTTGAACCCACTCCATGGAGCTCAGAGACTCCGAGCTGCCACTTTTCTGAA
rJMFF007J06- GAGGCGCCCCTTGAACCCACTCCATGGAGCTCAGAGACTCCGAGCTGCCACTTTTCTGAA
JMFF007J06+ GAGGCGCCCCTTGAACCCACTCCATGGAGCTCAGAGACTCCGAGCTGCCACTTTTCTGAA
JMFF031N04+ GAGGCGCCCCTTGAACCCACTCCATGGAGCTCAGAGACTCCGAGCTGCCACTTTTCTGAA
JMFF020H02+ GAGGCGCCCCTTGAACCCACTCCATGGAGCTCAGAGACTCCGAGCTGCCACTTTTCTGAA
                      ____________________________________________________________
consensus GAGGCGCCCCTTGAACCCACTCCATGGAGCTCAGAGACTCCGAGCTGCCACTTTTCTGAA
 
. : . : . : . : . : . :
rJMFF031N04- ACACTCCCTCGGGAGCCAAAAGTTCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
rJMFF038I02- ACACTCCCTCGGGAGCCAAAAGTTCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
rJMFF007J06- ACACTCCCTCGGGAGCCAAAAGTTCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
JMFF007J06+ ACACTCCCTCGGGAGCCAAAAGTTCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
JMFF031N04+ ACACTCCCTCGGGAGCCAAAAGTTCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
JMFF020H02+ ACACTCCCTCGGGAGCCAAAAGTCCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
JMFF038I02+ CTCGGGAGCCAAAAGTTCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
                      ____________________________________________________________
consensus ACACTCCCTCGGGAGCCAAAAGTTCCTCTGCTGCCAATCTTTCGTCAGTATTAGCAATAG
 
. : . : . : . : . : . :
rJMFF031N04- GAATCTTGACATCTAAAACTTCGGGG
rJMFF038I02- GAATCTTGACATCT
rJMFF007J06- GAATCTTGACATCTAGAACTTCGGGGCT-CCCCAAAAGATCCTTCTTG
JMFF007J06+ GAATCTTGACATCTAGAACTTCGGGGCT-CCCCAAAAGATCCTTCTTGCAATCATAGAAA
JMFF031N04+ GAATCTTGACATCTAGAACTTCGGGGCTCCCCCAAAAGATCCTTCTTGCAATCATAGAAA
JMFF020H02+ GAATCTTGACATCTAGAACTTCGGGGCT-CCCCAAAAGATCCTTCTTGCAATCATAGAAA
JMFF038I02+ GAATCTTGACATCTAGAACTTCGGGGCTCCCCCAAAAGATCCTTCTTGCAATCATAGAAA
                      ____________________________________________________________
consensus GAATCTTGACATCTAGAACTTCGGGGCT-CCCCAAAAGATCCTTCTTGCAATCATAGAAA
 
. : . : . : . : . : . :
JMFF007J06+ ACGTCATTGAAGAGCTGTTCATTCTCGAATGATGATTCGATGTCTGAAATTCTGAGTCCT
JMFF031N04+ ACGTCATTGAAGAGCTGTTCATTCTCGAATGATGATTCGATGTCTGAAATTCTGAGTCCT
JMFF020H02+ ACGTCATTGAAGAGCTGTTCATTCTCGAATGATGATTCGATGTCTGAAATTCTGAGTCCT
JMFF038I02+ ACGTCATTGAAGAGCTGTTCATTCTCGAATGATGATTCGATGTCTGAAATTCTGAGTCCT
                      ____________________________________________________________
consensus ACGTCATTGAAGAGCTGTTCATTCTCGAATGATGATTCGATGTCTGAAATTCTGAGTCCT
 
. : . : . : . : . : . :
JMFF007J06+ TGATGGGACATGACATCATCTCCACAAGAAATCATTGAAATGGCAGCTGTCATTGGATCA
JMFF031N04+ TGATGGGACATGACATCATCTCCACAAGAAATCATTGAAATGGCAGCTGTCATTGGATCA
JMFF020H02+ TGATGGGACATGACATCATCTCCACAAGAAATCATTGAAATGGCAGCTGTCATTGGATCA
JMFF038I02+ TGATGGGACATGACATCATCTCCACAAGAAATCATTGAAATGGCAGCTGTCATTGGATCA
                      ____________________________________________________________
consensus TGATGGGACATGACATCATCTCCACAAGAAATCATTGAAATGGCAGCTGTCATTGGATCA
 
. : . : . : . : . : . :
JMFF007J06+ ATATCCAACAGTGGTTCTTCAATAAGCGGTTCTGGAACATTGAAGAGGTCCCCCTCTCCA
JMFF031N04+ ATATCCAACAGTGGTTCTTCAATAAGCGGTTCTGGAACATTGAAGAGGTCCCCCTCTCCA
JMFF020H02+ ATATCCAACAGTGGTTCTTCAATAAGCGGTTCTGGAACATTGAAGAGGTCCCCCTCTCCA
JMFF038I02+ ATATCCAACAGTGGTTCTTCAATAAGCGGTTCTGGAACATTGAAGAGGTCCCCCTCTCCA
                      ____________________________________________________________
consensus ATATCCAACAGTGGTTCTTCAATAAGCGGTTCTGGAACATTGAAGAGGTCCCCCTCTCCA
 
. : . : . : . : . : . :
JMFF007J06+ CCGAGGTCATATTCTGATATAGCAGATGCCATTGGAGCATTGGGTTTCTGAGAGCAATAG
JMFF031N04+ CCGAGGTCATATTCTGATATAGCAGATGCCATTGGAGCATTGGGTTTCTGAGAGCAATAG
JMFF020H02+ CCGAGGTCATATTCTGATATAGCAGATGCCATTGGAGCATTGGGTTTCTGAGAGCAATAG
JMFF038I02+ CCGAGGTCATATTCTGATATAGCAGATGCCATTGGAGCATTGGGTTTCTGAGAGCAATAG
                      ____________________________________________________________
consensus CCGAGGTCATATTCTGATATAGCAGATGCCATTGGAGCATTGGGTTTCTGAGAGCAATAG
 
. : . : . : . : . : . :
JMFF007J06+ AACTCTTCAAGCTGTTGAACTTCTTGAGGAAAGCTCGGGAAGGAAGGAAA
JMFF031N04+ AACTCTTCAAGCTGTTGAACTTCTTGAGGAAAGCTCGGGAAGGAAGGAAAGATTAGCTCA
JMFF020H02+ AACTCTTCAAGCTGTTGAACTTCTTGAGGAAAGCTCGGGAAGGAAGGAAAGATTAGCTCA
JMFF038I02+ AACTCTTCAAGCTGTTGAACTTCTTGAGGAAAGCTCGGGAAGGAAGGAAAGATTAGCTCA
                      ____________________________________________________________
consensus AACTCTTCAAGCTGTTGAACTTCTTGAGGAAAGCTCGGGAAGGAAGGAAAGATTAGCTCA
 
. : . : . : . : . : . :
JMFF031N04+ GTCTCTGCATACATTTCTCTCTCTCTATATATATCTCTCTCTGGGCCAAATGAATT
JMFF020H02+ GTCTCTGCATACATTTCTCTCTCTCTATATATATCTCTCTCTGGGCCAAATGAATT
JMFF038I02+ GTCTCTGCATACATTTCTCTCTCTCTATATATATCTCTCTCTGGGCCAAATGAATTGAAT
                      ____________________________________________________________
consensus GTCTCTGCATACATTTCTCTCTCTCTATATATATCTCTCTCTGGGCCAAATGAATTGAAT