Previous Contig 001657:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024B07Sequence378001657 (16)gb:AY344229_16009383e-41Ipomoea batatas thioredoxin H1 mRNA, complete cds.680001657 (16)gb:AY344229_16009384e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFF033F22Sequence524001657 (16)gb:AY344229_16009382e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.658001657 (16)gb:AY344229_16009384e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFF038G11Sequence506001657 (16)gb:AY344229_16009381e-43Ipomoea batatas thioredoxin H1 mRNA, complete cds.732001657 (16)gb:AY344229_16009385e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFN005C19Sequence633001657 (16)gb:AY344229_16009383e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFN020A04Sequence622001657 (16)gb:AY344229_16009383e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFN032H19Sequence625001657 (16)gb:AY344229_16009383e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFN034D19Sequence626001657 (16)gb:AY344229_16009383e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFN037P14Sequence615001657 (16)gb:AY344229_16009383e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMFS169F10Sequence611001657 (16)gb:AY344229_16009383e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMSF021O14Sequence677001657 (16)gb:AY344229_16009384e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.628001657 (16)gb:AY344229_16009383e-44Ipomoea batatas thioredoxin H1 mRNA, complete cds.
JMSF042J19Sequence755001657 (16)gb:AY344229_16009381e-38Ipomoea batatas thioredoxin H1 mRNA, complete cds.722001657 (16)gb:AY344229_16009381e-38Ipomoea batatas thioredoxin H1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042J19- A
JMSF042J19+ TTTTCATACAAGATTTTTTTTGAAATTATCTAGCAAGCAA
                      ____________________________________________________________
consensus TTTTCATACAAGATTTTTTTTGAAATTATCTAGCAAGCAA
 
. : . : . : . : . : . :
rJMSF042J19- ACTTCTGCATAACACATAGAACAAAATACCCAGTTCACTAATGCCATAAAGATGAAAGCA
JMFN034D19+ CA
rJMFF024B07- GAACAAAATACCCAGTTCACTAATGCCATAAAGATGAAAGCA
JMSF042J19+ ACTTNTGCATAACACATAGAACAAAATACCCAGTTCACTAATGCCATAAAGATGAAAGCA
JMSF021O14+ AAGCA
                      ____________________________________________________________
consensus ACTTCTGCATAACACATAGAACAAAATACCCAGTTCACTAATGCCATAAAGATGAAAGCA
 
. : . : . : . : . : . :
rJMSF042J19- AAGCAGACATGGTTGCATTATCTCAAATCCATATCTTCCATACAAAAGCTTGCATGACTT
JMFN034D19+ AAGCAGACATGGTNGCATTATCTCAAATCCATATCTTCCATACAAAAGCTTGCATGACTT
rJMFF024B07- AAGCAGACATGGTTGCATTATCTCAAATCCATATCTTCCATACAAAAGCTTGCATGACTT
JMSF042J19+ AAGCAGACATGGTTGCATTATCTCAAATCCATATCTTCCATACAAAAGCTTGCATGACTT
JMFN032H19+ TCCATACAAAAGCTTGCATGACTT
rJMFF033F22- GGTTGCATTATCTC-AATCCATATCTTCCATACAAAAGCTTGCATGACTT
JMFN037P14+ TCCATACAAAAGCTTGCATGACTT
JMFS169F10+ TCCATACAAAAGCTTGCATGACTT
JMFN005C19+ ATCTCAAATCCATATCTTCCATACAAAAGCTTGCATGACTT
rJMSF021O14- CAAAAGCTTGCATGACTT
JMSF021O14+ AAGCAGACATGGTTGCATTATCTCAAATCCATATCTTCCATACAAAAGCTTGCATGACTT
rJMFF038G11- AAAGCTTGCATGACTT
                      ____________________________________________________________
consensus AAGCAGACATGGTTGCATTATCTCAAATCCATATCTTCCATACAAAAGCTTGCATGACTT
 
. : . : . : . : . : . :
rJMSF042J19- GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMFN034D19+ GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
rJMFF024B07- GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMSF042J19+ GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMFN032H19+ GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
rJMFF033F22- GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMFN037P14+ GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMFS169F10+ GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMFN005C19+ GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
rJMSF021O14- GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMSF021O14+ GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
JMFN020A04+ AA
rJMFF038G11- GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCAACTATGAGAA
                      ____________________________________________________________
consensus GATACAGTGAGTCAAAGCTGCAAACTACAGAACTAGAAGCATTGAAACCGACTATGAGAA
 
. : . : . : . : . : . :
rJMSF042J19- CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMFN034D19+ CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
rJMFF024B07- CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMSF042J19+ CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMFN032H19+ CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
rJMFF033F22- CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMFN037P14+ CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMFS169F10+ CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMFN005C19+ CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
rJMSF021O14- CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMFF033F22+ TAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMSF021O14+ CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
JMFN020A04+ CCACAGTTGTTTNTGTTATTGTTATTAGATANAAACGAAGCAAGTCGGTTAGTCGGGTGG
rJMFF038G11- CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
                      ____________________________________________________________
consensus CCACAGTTGTTTTTGTTATTGTTATTAGATAAAAACGAAGCAAGTCGGTTAGTCGGGTGG
 
. : . : . : . : . : . :
rJMSF042J19- GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMFN034D19+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
rJMFF024B07- GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMSF042J19+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMFN032H19+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
rJMFF033F22- GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMFN037P14+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMFS169F10+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMFN005C19+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
rJMSF021O14- GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMFF033F22+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMSF021O14+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
JMFN020A04+ GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
rJMFF038G11- GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
                      ____________________________________________________________
consensus GGGGGAATTATTTGTTCTTTGAAAGCTCAGGCTGTCATGGTAGAAGCAGCAGCAGCATGC
 
. : . : . : . : . : . :
rJMSF042J19- GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFN034D19+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
rJMFF024B07- GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMSF042J19+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFN032H19+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFF024B07+ CTCGTTT
rJMFF033F22- GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFN037P14+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFS169F10+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFN005C19+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
rJMSF021O14- GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFF033F22+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMSF021O14+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFN020A04+ GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
rJMFF038G11- GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
JMFF038G11+ CCCCCACAACCCTATGGACCTCGTTT
                      ____________________________________________________________
consensus GTGGCTATGCAACTAAGCAGTTCTTCTTTCTTGGCCCCCACAACCCTATGGACCTCGTTT
 
. : . : . : . : . : . :
rJMSF042J19- CCTTCTTTCAGGAAGAC-AAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFN034D19+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
rJMFF024B07- CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMSF042J19+ CCTTCTTTCAGGAAGAC-AAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFN032H19+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFF024B07+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
rJMFF033F22- CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFN037P14+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFS169F10+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFN005C19+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
rJMSF021O14- CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFF033F22+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMSF021O14+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFN020A04+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
rJMFF038G11- CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
JMFF038G11+ CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
                      ____________________________________________________________
consensus CCTTCTTTCAGGAAGACAAAAGTTGGCATGGCCTCAACCTTAAAGTCCTCAGACACAGAC
 
. : . : . : . : . : . :
rJMSF042J19- TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFN034D19+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
rJMFF024B07- TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMSF042J19+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFN032H19+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFF024B07+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
rJMFF033F22- TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFN037P14+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFS169F10+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFN005C19+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
rJMSF021O14- TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFF033F22+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMSF021O14+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFN020A04+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
rJMFF038G11- TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
JMFF038G11+ TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
                      ____________________________________________________________
consensus TTCAGCTCATCCACGTCCACCTTGAGAAATATCACTTGTGGCATCTTCTTTGCGATATCT
 
. : . : . : . : . : . :
rJMSF042J19- GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFN034D19+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
rJMFF024B07- GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMSF042J19+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFN032H19+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFF024B07+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
rJMFF033F22- GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFN037P14+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFS169F10+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFN005C19+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
rJMSF021O14- GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFF033F22+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMSF021O14+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFN020A04+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
rJMFF038G11- GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
JMFF038G11+ GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
                      ____________________________________________________________
consensus GCCAGAATTGGAGCAATAAAACGGCAAGGCCCGCACCAAGAAGCAGTAAAATCTACCACT
 
. : . : . : . : . : . :
rJMSF042J19- GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFN034D19+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
rJMFF024B07- GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMSF042J19+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFN032H19+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFF024B07+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
rJMFF033F22- GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFN037P14+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFS169F10+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFN005C19+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
rJMSF021O14- GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFF033F22+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMSF021O14+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFN020A04+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
rJMFF038G11- GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
JMFF038G11+ GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
                      ____________________________________________________________
consensus GCCAGTTTCTTGCTCTCTTTGGCTTTGTTGAAGTGTTCGGTCCACTGCTCGACGGTGTGG
 
. : . : . : . : . : . :
rJMSF042J19- CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFN034D19+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
rJMFF024B07- CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMSF042J19+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFN032H19+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFF024B07+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
rJMFF033F22- CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFN037P14+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFS169F10+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFN005C19+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
rJMSF021O14- CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFF033F22+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMSF021O14+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFN020A04+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
rJMFF038G11- CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
JMFF038G11+ CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
                      ____________________________________________________________
consensus CAGCCGATAACTTGTCCCTCCTCTGCTGCCATCTCCTCTCGCGGTTTCTGCAAAGATTAA
 
. : . : . : . : . : . :
rJMSF042J19- CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTC
JMFN034D19+ CACTAAACTTGCGCTAGTCGACAG
rJMFF024B07- CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCA
JMSF042J19+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTC
JMFN032H19+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
JMFF024B07+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
rJMFF033F22- CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
JMFN037P14+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATT
JMFS169F10+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAG
JMFN005C19+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTC
rJMSF021O14- CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
JMFF033F22+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
JMSF021O14+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
JMFN020A04+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
rJMFF038G11- CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
JMFF038G11+ CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
                      ____________________________________________________________
consensus CACTAAACTTGCGCTAGTCGACAGATCTCGAGTCTCCACCAGTTGAGATTTCTTCTTCTT
 
. : . : . : . : . : . :
JMFN032H19+ C
JMFF024B07+ CTTCAAC
rJMFF033F22- CTTCAACAC
rJMSF021O14- CTTCAACAC
JMFF033F22+ CTTCAACAC
JMSF021O14+ CTTCAACAC
JMFN020A04+ CTTCAACACGCTTGTCAATCCTTTTCTGCGAATCGAGTTTATCGTCCAAGAGGCAGATGA
rJMFF038G11- CTTCAACACGCTTGTCAATCCTTTTCTGCGAATCGAGTTTATCGTCCAAGAGGCAGATGA
JMFF038G11+ CTTCAACACGCTTGTCAATCCTTTTCTGCGAATCGAGTTTATCGTCCAAGAGGCAGATGA
                      ____________________________________________________________
consensus CTTCAACACGCTTGTCAATCCTTTTCTGCGAATCGAGTTTATCGTCCAAGAGGCAGATGA
 
. : . : . : . : . : . :
JMFN020A04+ AATTACAAAAATGTAACGTC
rJMFF038G11- AATTACAAAAATGTAACGTCTTTGGACCTAAATTACGGAATATACCATTCTCGAAA
JMFF038G11+ AATTACAAAAATGTAACGTCTTTGGACCTAAATTACGGAATATACCATTCTCGAAACTCC
                      ____________________________________________________________
consensus AATTACAAAAATGTAACGTCTTTGGACCTAAATTACGGAATATACCATTCTCGAAACTCC