Previous Contig 001654:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004A20Sequence560001654 (6)gb:AB010717_15112722e-39Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni738010281 (5)gb:AB010717_15112721e-60Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni
JMFF038F02Sequence513001654 (6)gb:AB010717_15112725e-24Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni761010281 (5)gb:AB010717_15112729e-57Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni
JMFF043C08Sequence646001654 (6)gb:AB010717_15112728e-49Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni631010281 (5)gb:AB010717_15112724e-26Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni
JMFS125G03Sequence567001654 (6)gb:AB010717_15112723e-50Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni
JMSF024M18Sequence661001654 (6)gb:AB010717_15112724e-57Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni772010281 (5)gb:AB010717_15112724e-69Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni
JMSF030P19Sequence616001654 (6)gb:AB010717_15112723e-58Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni722010281 (5)gb:AB010717_15112725e-56Nicotiana tabacum gene for sulfite reductase, complete cds.>gb:D83583_1674832 Ni

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024M18+ CTTAA
                      ____________________________________________________________
consensus CTTAA
 
. : . : . : . : . : . :
JMSF030P19+ AATGTTTGTCTCGTTGTCAATCGAAGGGTTC
JMSF024M18+ GGTCTTTCTTCAGGACACCATGGAGTTGAAATGTTTGTCTCGTTGTCAATCGAAGGGTTC
                      ____________________________________________________________
consensus GGTCTTTCTTCAGGACACCATGGAGTTGAAATGTTTGTCTCGTTGTCAATCGAAGGGTTC
 
. : . : . : . : . : . :
JMSF030P19+ CAATTCCAAATTGGTCAGCAAGATCATCCATGACCAAGTAGAGTCTGTTTGGAACCTTTC
JMFS125G03+ TCAGCAAGATCATCCATGACCAAGTAGAGTCTGTTTGGAACCTTTC
JMSF024M18+ CAATTCCAAATTGGTCAGCAAGATCATCCATGACCAAGTAGAGTCTGTTTGGAACCTTTC
JMFF043C08+ TCAGCAAGATCATCCATGACCAAGTAGAGTCTGTTNGGAACCTTTC
                      ____________________________________________________________
consensus CAATTCCAAATTGGTCAGCAAGATCATCCATGACCAAGTAGAGTCTGTTTGGAACCTTTC
 
. : . : . : . : . : . :
JMSF030P19+ CACCAGGGTTTTTTGTTCGGAGCATAAATGAATATGACCTTTTCCCACGCTCATCTCTAT
JMFS125G03+ CACCAGGGTTTTTTGTTCGGAGCATAAATGAATATGACCTTTTCCCACGCTCATCTCTAT
JMSF024M18+ CACCAGGGTTTTTTGTTCGGAGCATAAATGAATATGACCTTTTCCCACGCTCATCTCTAT
JMFF004A20+ GGGTTTTTTGTTCGGAGCATAAATGAATATGACCTTTTCCCACGCTCATCTCTAT
JMFF043C08+ CACCAGGGTTTTTTGTTCGGAGCATAAATGAATATGACCTTTTCCCACGCTCATCTCTAT
                      ____________________________________________________________
consensus CACCAGGGTTTTTTGTTCGGAGCATAAATGAATATGACCTTTTCCCACGCTCATCTCTAT
 
. : . : . : . : . : . :
JMSF030P19+ TATATTGTTGATAACTCCCATGAAACTTGATCAATTGAGTAGCAGCCTCATTGATGTTAG
JMFS125G03+ TATATTGTTGATAACTCCCATGAAACTTGATCAATTGAGTAGCAGCCTCATTGATGTTAG
JMSF024M18+ TATATTGTTGATAACTCCCATGAAACTTGATCAATTGAGTAGCAGCCTCATTGATGTTAG
JMFF004A20+ TATATTGTTGATAACTCCCATGAAACTTGATCAATTGAGTAGCAGCCTCATTGATGTTAG
JMFF043C08+ TATATTGTTGATAACTCCCATGAAACTTGATCAATTGAGTAGCAGCCTCATTGATGTTAG
JMFF038F02+ TGATCAATTGAGTAGCAGCCTCATTGATGTTAG
                      ____________________________________________________________
consensus TATATTGTTGATAACTCCCATGAAACTTGATCAATTGAGTAGCAGCCTCATTGATGTTAG
 
. : . : . : . : . : . :
JMSF030P19+ GTGCATCTGTAAGAATTTCCTCATTGAGAGGATACCTTATGAAGTTACTTTGCTCTTTGA
JMFS125G03+ GTGCATCTGTAAGAATTTCCTCATTGAGAGGATACCTTATGAAGTTACTTTGCTCTTTGA
JMSF024M18+ GTGCATCTGTAAGAATTTCCTCATTGAGAGGATACCTTATGAAGTTACTTTGCTCTTTGA
JMFF004A20+ GTGCATCTGTAAGAATTTCCTCATTGAGAGGATACCTTATGAAGTTACTTTGCTCTTTGA
JMFF043C08+ GTGCATCTGTAAGAATTTCCTCATTGAGAGGATACCTTATGAAGTTACTTTGCTCTTTGA
JMFF038F02+ GTGCATCTGTAAGAATTTCCTCATTGAGAGGATACCTTATGAAGTTACTTTGCTCTTTGA
                      ____________________________________________________________
consensus GTGCATCTGTAAGAATTTCCTCATTGAGAGGATACCTTATGAAGTTACTTTGCTCTTTGA
 
. : . : . : . : . : . :
JMSF030P19+ ATATTTCAACCTTGCTACGTTTAGGTTTGGCAGAAGTGTCCAACTCCGATGGCGTCGTTA
JMFS125G03+ ATATTTCAACCTTGCTACGTTTAGGTTTGGCAGAAGTGTCCAACTCCGATGGCGTCGTTA
JMSF024M18+ ATATTTCAACCTTGCTACGTTTAGGTTTGGCAGAAGTGTCCAACTCCGATGGCGTCGTTA
JMFF004A20+ ATATTTCAACCTTGCTACGTTTAGGTTTGGCAGAAGTGTCCAACTCCGATGGCGTCGTTA
JMFF043C08+ ATATTTCAACCTTGCTACGTTTAGGTTTGGCAGAAGTGTCCAACTCCGATGGCGTCGTTA
JMFF038F02+ ATATTTCAACCTTGCTACGTTTAGGTTTGGCAGAAGTGTCCAACTCCGATGGCGTCGTTA
                      ____________________________________________________________
consensus ATATTTCAACCTTGCTACGTTTAGGTTTGGCAGAAGTGTCCAACTCCGATGGCGTCGTTA
 
. : . : . : . : . : . :
JMSF030P19+ CGGCTCTAATGACCGAAACGTTAGGACTCGAAGCCGAGGCAGCGCGAAACACGTGAAGAC
JMFS125G03+ CGGCTCTAATGACCGAAACGTTAGGACTCGAAGCCGAGGCAGCGCGAAACACGTGAAGAC
JMSF024M18+ CGGCTCTAATGACCGAAACGTTAGGACTCGAAGCCGAGGCAGCGCGAAACACGTGAAGAC
JMFF004A20+ CGGCTCTAATGACCGAAACGTTAGGACTCGAAGCCGAGGCAGCGCGAAACACGTGAAGAC
JMFF043C08+ CGGCTCTAATGACCGAAACGTTAGGACTCGAAGCCGAGGCAGCGCGAAACACGTGAAGAC
JMFF038F02+ CGGCTCTAATGACCGAAACGTTAGGACTCGAAGCCGAGGCAGCGCGAAACACGTGAAGAC
                      ____________________________________________________________
consensus CGGCTCTAATGACCGAAACGTTAGGACTCGAAGCCGAGGCAGCGCGAAACACGTGAAGAC
 
. : . : . : . : . : . :
JMSF030P19+ GGTTGCTGAGGCGGAGCGAATCGGAGCCGCTCCTCAGCCCGGTGCAACTGGGAATTTGAA
JMFS125G03+ GGTTGCTGAGGCGGAGCGAATCGGAGCCGCTCCTCAGCCCGGTGCAACTGGGAATTTGAA
JMSF024M18+ GGTTGCTGAGGCGGAGCGAATCGGAGCCGCTCCTCAGCCCGGTGCAACTGGGAATTTGAA
JMFF004A20+ GGTTGCTGAGGCGGAGCGAATCGGAGCCGCTCCTCAGCCCGGTGCAACTGGGAATTTGAA
JMFF043C08+ GGTTGCTGAGGCGGAGCGAATCGGAGCCGCTCCTCAGCCCGGTGCAACTGGGAATTTGAA
JMFF038F02+ GGTTGCTGAGGCGGAGCGAATCGGAGCCGCTCCTCAGCCCGGTGCAACTGGGAATTTGAA
                      ____________________________________________________________
consensus GGTTGCTGAGGCGGAGCGAATCGGAGCCGCTCCTCAGCCCGGTGCAACTGGGAATTTGAA
 
. : . : . : . : . : . :
JMSF030P19+ TCTTCGGATCCTTGGAGATGGCGGTCCTAGCCGCTGCTGCTCCAAACGACGTCGTCATCC
JMFS125G03+ TCTTCGGATCCTTGGAGATGGCGGTCCTAGCCGCTGCTGCTCCAAACGACGTCGTCATCC
JMSF024M18+ TCTTCGGATCCTTGGAGATGGCGGTCCTAGCCGCTGCTGCTCCAAACGACGTCGTCATCC
JMFF004A20+ TCTTCGGATCCTTGGAGATGGCGGTCCTAGCCGCTGCTGCTCCAAACGACGTCGTCATCC
JMFF043C08+ TCTTCGGATCCTTGGAGATGGCGGTCCTAGCCGCTGCTGCTCCAAACGGCGTCGTCATCC
JMFF038F02+ TCTTCGGATCCTTGGAGATGGCGGTCCTAGCCGCTGCTGCTCCAAACGGCGTCGTCATCC
                      ____________________________________________________________
consensus TCTTCGGATCCTTGGAGATGGCGGTCCTAGCCGCTGCTGCTCCAAACGACGTCGTCATCC
 
. : . : . : . : . : . :
JMSF030P19+ CCTCCGACAGAAACAGAAAACGACGGAGAGAATTTCCCTACCGGAAAAGGAGCTTTGATC
JMFS125G03+ CCTCCGACAGAAACAGAAAACGACGGAGAGAATTTCCCTACCGGAAAAGGAGCTTTGATC
JMSF024M18+ CCTCCGACAGAAACAGAAAACGACGGAGAGAATTTCCCTACCGGAAAAGGAGCTTTGATC
JMFF004A20+ CCTCCGACAGAAACAGAAAACGACGGAGAGAATTTCCCTACCGGAAAAGGAGCTTTGATC
JMFF043C08+ CCTCCGACAGAAACAGAAAACGACGGAGAGAATTTCCCTACCGGAAAAGGAGCTTTGATC
JMFF038F02+ CCTCCGACAGAAACAGAAAACGACGGAGAGAATTTCCCTACCGGAAAAGGAGCTTTGATC
                      ____________________________________________________________
consensus CCTCCGACAGAAACAGAAAACGACGGAGAGAATTTCCCTACCGGAAAAGGAGCTTTGATC
 
. : . : . : . : . : . :
JMSF030P19+ AAAGGCGATTGAGGAGATTTTCCGGCTGAGAAACAATGAAGAAC
JMFS125G03+ AAAGGCGATTGAGGAGATTTTCCGGCTGAGAAACAATGAA
JMSF024M18+ AAAGGCGATTGAGGAGATTTTCCGGCTGAGAAACAATGAAGAACAGAGAAGAGTT
JMFF004A20+ AAAGGCGATTGAGGAGATTTTCCGGCTGAGAAACAATGAAGAACAGAGAAGAGTTGGACT
JMFF043C08+ AAAGGCGATTGAGGAGATTTTCCGGCTGAGAAACAATGAAGAACAGAGAAGAGTTGGACT
JMFF038F02+ AAAGGCGATTGAGGAGATTTTCCGGCTGAGAAACAATGAAGAACAGAGAAGAGTTGGACT
                      ____________________________________________________________
consensus AAAGGCGATTGAGGAGATTTTCCGGCTGAGAAACAATGAAGAACAGAGAAGAGTTGGACT
 
. : . : . : . : . : . :
JMFF004A20+ GCGAGAGGGATATTTCGCAGTTTAT
JMFF043C08+ GCGAGAGGGATATTTCGCAGTTTATATACTGAAAAGTGCGAAACGCAATTATGCAAATGC
JMFF038F02+ GCGAGAGGGATATTTCGCAGTTTATATACTGAAAAGTGCGAAACGCAATTATGCAAATGC
                      ____________________________________________________________
consensus GCGAGAGGGATATTTCGCAGTTTATATACTGAAAAGTGCGAAACGCAATTATGCAAATGC