Previous Contig 001650:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008N02Sequence584001650 (5)gb:AY065075_15662292e-23Arabidopsis thaliana dTDP-glucose 4-6-dehydratase-like protein (F4P12.220) mRNA,721009390 (7)gb:AY619953_16183234e-79Nicotiana tabacum putative UDP-glucuronate decarboxylase 4 mRNA, partial cds.
JMFF025E23Sequence584001650 (5)gb:AY065075_15662296e-24Arabidopsis thaliana dTDP-glucose 4-6-dehydratase-like protein (F4P12.220) mRNA,804009390 (7)gb:AY619953_16183232e-85Nicotiana tabacum putative UDP-glucuronate decarboxylase 4 mRNA, partial cds.
JMFF038D03Sequence543001650 (5)gb:AY065075_15662293e-17Arabidopsis thaliana dTDP-glucose 4-6-dehydratase-like protein (F4P12.220) mRNA,744009390 (7)gb:AY619953_16183232e-84Nicotiana tabacum putative UDP-glucuronate decarboxylase 4 mRNA, partial cds.
JMSF040F14Sequence605001650 (5)gb:AY065075_15662298e-32Arabidopsis thaliana dTDP-glucose 4-6-dehydratase-like protein (F4P12.220) mRNA,871009390 (7)gb:AY619953_1618323e-102Nicotiana tabacum putative UDP-glucuronate decarboxylase 4 mRNA, partial cds.
JMSF042C18Sequence807001650 (5)gb:AY065075_15662295e-67Arabidopsis thaliana dTDP-glucose 4-6-dehydratase-like protein (F4P12.220) mRNA,819009390 (7)gb:AY619953_16183232e-97Nicotiana tabacum putative UDP-glucuronate decarboxylase 4 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042C18+ TGACAGGATTATACTTGTAATGANCCGGGGAAGCAGGCCAAGC
                      ____________________________________________________________
consensus TGACAGGATTATACTTGTAATGANCCGGGGAAGCAGGCCAAGC
 
. : . : . : . : . : . :
JMSF042C18+ CAAGTGGTAAATCTGATCGACCTCCAGCAAAATGGGCTCCACAACATCATGTCGGATGAG
                      ____________________________________________________________
consensus CAAGTGGTAAATCTGATCGACCTCCAGCAAAATGGGCTCCACAACATCATGTCGGATGAG
 
. : . : . : . : . : . :
JMSF042C18+ CTCAAACCTCGGATTCCCGAAATGGTGCATCACGTTCTCCTTCCTGCCGGTGAAGAAATT
                      ____________________________________________________________
consensus CTCAAACCTCGGATTCCCGAAATGGTGCATCACGTTCTCCTTCCTGCCGGTGAAGAAATT
 
. : . : . : . : . : . :
JMSF040F14+ TCTTCATCAGCTNATCGACCAAATGACTGCCGAC
JMSF042C18+ ATCAATGACGATCACATCGTCGCCTCTCTTCATCAGCTTATCGACCAAATGACTGCCGAC
                      ____________________________________________________________
consensus ATCAATGACGATCACATCGTCGCCTCTCTTCATCAGCTTATCGACCAAATGACTGCCGAC
 
. : . : . : . : . : . :
JMSF040F14+ GAACCCGGCCCCGCCGGTGATCACAATCCGCATCCGCTTCCTCGCAATCCCGACGGGCAC
JMSF042C18+ GAACCCGGCCCCGCCGGTGATCACAATCCGCATCCGCTTCCTCGCAATCCCGACGGGCAC
JMFF025E23+ GTGATCACAATCCGCATCCGCTTCCTCGCAATCCCGACGGGCAC
JMFF008N02+ GTGATCACAATCCGCATCCGCTTCCTCGCAATCCCGACGGGCAC
JMFF038D03+ CAC
                      ____________________________________________________________
consensus GAACCCGGCCCCGCCGGTGATCACAATCCGCATCCGCTTCCTCGCAATCCCGACGGGCAC
 
. : . : . : . : . : . :
JMSF040F14+ TCTCCCGATCCCGGCCGCGCCATATCCGCTACTCCTGGCAGGGGTATACTCGGGGAGCGC
JMSF042C18+ TCTCCCGATCCCGGCCGCGCCATATCCGCTACTCCTGGCAGGGGTATACTCGGGGAGCGC
JMFF025E23+ TCTCCCGATCCCGGCCGCGCCATATCCGCTACTCCTGGCAGGGGTATACTCGGGGAGCGC
JMFF008N02+ TCTCCCGATCCCGGCCGCGCCATATCCGCTACTCCTGGCAGGGGTATACTCGGGGAGCGC
JMFF038D03+ TCTCCCGATCCCGGCCGCGCCATATCCGCTACTCCTGGCAGGGGTATACTCGGGGAGCGC
                      ____________________________________________________________
consensus TCTCCCGATCCCGGCCGCGCCATATCCGCTACTCCTGGCAGGGGTATACTCGGGGAGCGC
 
. : . : . : . : . : . :
JMSF040F14+ CTCCCTGTTGGAGAGGTGGAAAGAGTGGGATCTGGGAATCGGGGAAGAAGAGCTGAGATG
JMSF042C18+ CTCCCTGTTGGAGAGGTGGAAAGAGTGGGATCTGGGAATCGGGGAAGAAGAGCTGAGATG
JMFF025E23+ CTCCCTGTTGGAGAGGTGGAAAGAGTGGGATCTGGGAATCGGGGAAGAAGAGCTGAGATG
JMFF008N02+ CTCCCTGTTGGAGAGGTGGAAAGAGTGGGATCTGGGAATCGGGGAAGAAGAGCTGAGATG
JMFF038D03+ CTCCCTGTTGGAGAGGTGGAAAGAGTGGGATCTGGGAATCGGGGAAGAAGAGCTGAGATG
                      ____________________________________________________________
consensus CTCCCTGTTGGAGAGGTGGAAAGAGTGGGATCTGGGAATCGGGGAAGAAGAGCTGAGATG
 
. : . : . : . : . : . :
JMSF040F14+ TGAAAGGCTGGGCTGGATGATGAAGAAAGTGGAGCCAATGAGAATACCGACGAGAATGAA
JMSF042C18+ TGAAAGGCTGGGCTGGATGATGAAGAAAGTGGAGCCAATGAGAATACCGACGAGAATGAA
JMFF025E23+ TGAAAGGCTGGGCTGGATGATGAAGAAAGTGGAGCCAATGAGAATACCGACGAGAATGAA
JMFF008N02+ TGAAAGGCTGGGCTGGATGATGAAGAAAGTGGAGCCAATGAGAATACCGACGAGAATGAA
JMFF038D03+ TGAAAGGCTGGGCTGGATGATGAAGAAAGTGGAGCCAATGAGAATACCGACGAGAATGAA
                      ____________________________________________________________
consensus TGAAAGGCTGGGCTGGATGATGAAGAAAGTGGAGCCAATGAGAATACCGACGAGAATGAA
 
. : . : . : . : . : . :
JMSF040F14+ CAAAAGCCTCTGCTCTCTGAGGAGATAGTTGATGGATCTGGGTAGAGATCTGGGGTGTTT
JMSF042C18+ CAAAAGCCTCTGCTCTCTGAGGAGATAGTTGATGGATCTGGGTAGAGATCTGGGGTGTTT
JMFF025E23+ CAAAAGCCTCTGCTCTCTGAGGAGATAGTTGATGGATCTGGGTAGAGATCTGGGGTGTTT
JMFF008N02+ CAAAAGCCTCTGCTCTCTGAGGAGATAGTTGATGGATCTGGGTAGAGATCTGGGGTGTTT
JMFF038D03+ CAAAAGCCTCTGCTCTCTGAGGAGATAGTTGATGGATCTGGGTAGAGATCTGGGGTGTTT
                      ____________________________________________________________
consensus CAAAAGCCTCTGCTCTCTGAGGAGATAGTTGATGGATCTGGGTAGAGATCTGGGGTGTTT
 
. : . : . : . : . : . :
JMSF040F14+ CAGGGTTTTGGGGGAGTAAGGCGGGGTATTCTGGGCCGTCTCTTCATCTCTTCTGTAATT
JMSF042C18+ CAGGGTTTTGGGGGAGTAAGGCGGGGTATTCTGGGCCGTCTCTTCATCTCTTCTGTAATT
JMFF025E23+ CAGGGTTTTGGGGGAGTAAGGCGGGGTATTCTGGGCCGTCTCTTCATCTCTTCTGTAATT
JMFF008N02+ CAGGGTTTTGGGGGAGTAAGGCGGGGTATTCTGGGCCGTCTCTTCATCTCTTCTGTAATT
JMFF038D03+ CAGGGTTTTGGGGGAGTAAGGCGGGGTATTCTGGGCCGTCTCTTCATCTCTTCTGTAATT
                      ____________________________________________________________
consensus CAGGGTTTTGGGGGAGTAAGGCGGGGTATTCTGGGCCGTCTCTTCATCTCTTCTGTAATT
 
. : . : . : . : . : . :
JMSF040F14+ CACGCTCGCCTGTTTGTGCAATTTCATGGCGAATTCCTCCTCTCTGTCTGTCTTGAATTA
JMSF042C18+ CACGCTCGCCTGTTTGTGCAATTTCATGGCGAATTCCTCCTCTCTGTCTGTCTTGAATTA
JMFF025E23+ CACGCTCGCCTGTTTGTGCAATTTCATGGCGAATTCCTCCTCTCTGTCTGTCTCGAATTA
JMFF008N02+ CACGCTCGCCTGTTTGTGCAATTTCATGGCGAATTCCTCCTCTCTGTCTGTCTTGAATTA
JMFF038D03+ CACGCTCGCCTGTTTGTGCAATTTCATGGCGAATTCCTCCTCTCTGTCTGTCTTGAATTA
                      ____________________________________________________________
consensus CACGCTCGCCTGTTTGTGCAATTTCATGGCGAATTCCTCCTCTCTGTCTGTCTTGAATTA
 
. : . : . : . : . : . :
JMSF040F14+ TCGAGTTTTCGAATCCTTTTTTCAGGTGAAAAATGGAGGCTTGAATTGCTCTGCAACTGA
JMSF042C18+ TCGAGTTTTCGAATCCTTTTTTCAGGTGAAAAATGGAGGCTTGAATTGCTCTGCAACTGA
JMFF025E23+ TCGAGTTTTCTAATCCTTTTTTCAGGTGAAAAATGGAGGCTTGAATTGCTCTGCAACTGA
JMFF008N02+ TCGAGTTTTCGAATCCTTTTTTCAGGTGAAAAATGGAGGCTTGAATTGCTCTGCAACTGA
JMFF038D03+ TCGAGTTTTCGAATCCTTTTTTCAGGTGAAAAATGGAGGCTTGAATTGCTCTGCAACTGA
                      ____________________________________________________________
consensus TCGAGTTTTCGAATCCTTTTTTCAGGTGAAAAATGGAGGCTTGAATTGCTCTGCAACTGA
 
. : . : . : . : . : . :
JMSF040F14+ AATGCAAATCGGCTGTGTATATATTGGAAGACAAAGAAGTGGTAGGTGCTTGAAGGCGCT
JMSF042C18+ AATGCAAATCGGCTGTGTATATATTGGAAGACAAAGAAGTGGTAGGTGCTTGAAGGCGCT
JMFF025E23+ AATGCAAATCGGCTGTGTATATATTGGAAGACAAAGAAGTGGTAGGTGCTTGAAGGCGCT
JMFF008N02+ AATGCAAATCGGCTGTGTATATATTGGAAGACAAAGAAGTGGTAGGTGCTTGAAGGCGCT
JMFF038D03+ AATGCAAATCGGCTGTGTATATATTGGAAGACAAAGAAGTGGTAGGTGCTTGAAGGCGCT
                      ____________________________________________________________
consensus AATGCAAATCGGCTGTGTATATATTGGAAGACAAAGAAGTGGTAGGTGCTTGAAGGCGCT
 
. : . : . : . : . : . :
JMSF040F14+ ACCTGAACTTCTCTTCTCTTTCAACAGTTT
JMSF042C18+ ACCTGAACTTCTCTTCTCTTTCAACAGTTTGAAGAGAGAGAGT
JMFF025E23+ ACCTGAACTTCTCTTCTCTTTCAACAGTTTGAAGAGAGAGAGTGAATGGCAATGG
JMFF008N02+ ACCTGAACTTCTCTTCTCTTTCAACAGTTTGAAGAGAGAGAGTGAATGGCAATGG
JMFF038D03+ ACCTGAACTTCTCTTCTCTTTCAACAGTTTGAAGAGAGAGAGTGAATGGCAATGGCCAAT
                      ____________________________________________________________
consensus ACCTGAACTTCTCTTCTCTTTCAACAGTTTGAAGAGAGAGAGTGAATGGCAATGGCCAAT