Previous Contig 001645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038B10Sequence531001645 (2)689021536gb:BT005934_16388561e-39Arabidopsis thaliana At2g19260 gene, complete cds.>gb:AK118428_1816406 Arabidops
JMFS046A06Sequence625001645 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS046A06+ GACTTGGAAGACGAACAATTCTC
                      ____________________________________________________________
consensus GACTTGGAAGACGAACAATTCTC
 
. : . : . : . : . : . :
JMFS046A06+ ATTTAGGCATGGGTTCAATAAACCAAGTGTATCACTTCTTGAAGCTTCTTCTGAACAGCG
                      ____________________________________________________________
consensus ATTTAGGCATGGGTTCAATAAACCAAGTGTATCACTTCTTGAAGCTTCTTCTGAACAGCG
 
. : . : . : . : . : . :
JMFS046A06+ ATAGTCCCCATCAGGACATCCATTACATGATTCTGACTTCGAGAAGAGGGGTTCTGCATT
                      ____________________________________________________________
consensus ATAGTCCCCATCAGGACATCCATTACATGATTCTGACTTCGAGAAGAGGGGTTCTGCATT
 
. : . : . : . : . : . :
JMFS046A06+ GCGTTCTACAGGGGTCCTATTTGAAGATCTAGTAGCATCTGTTTCAACCTCCAATTCAAA
                      ____________________________________________________________
consensus GCGTTCTACAGGGGTCCTATTTGAAGATCTAGTAGCATCTGTTTCAACCTCCAATTCAAA
 
. : . : . : . : . : . :
JMFS046A06+ AATTCTTTGTTCCTTCCCACCCCCTGAAAGAGCTTCAGAACACATGGCAGAATCACAACC
                      ____________________________________________________________
consensus AATTCTTTGTTCCTTCCCACCCCCTGAAAGAGCTTCAGAACACATGGCAGAATCACAACC
 
. : . : . : . : . : . :
JMFS046A06+ GCCAGCACATCCAACTTTAGCTGATGATTGGGGTGGGCAAGTAGGAGGGGTGTTTCTCTG
                      ____________________________________________________________
consensus GCCAGCACATCCAACTTTAGCTGATGATTGGGGTGGGCAAGTAGGAGGGGTGTTTCTCTG
 
. : . : . : . : . : . :
JMFS046A06+ GAACTTTTTCCGGTAGTATACAGCAAGGTTAGAACTTCCTGAAATAGTTCTGAAAGCTGA
JMFF038B10+ CCGGTAGTATACAGCAAGGTTAGAACTTCCTGAAATAGTTCTGAAAGCTGA
                      ____________________________________________________________
consensus GAACTTTTTCCGGTAGTATACAGCAAGGTTAGAACTTCCTGAAATAGTTCTGAAAGCTGA
 
. : . : . : . : . : . :
JMFS046A06+ TAGCTGAGAAACACTTGGAGGAGCTAAGGAACAGGGGCTGAGGCCATCGTCAGCTTTGGA
JMFF038B10+ TAGCTGAGAAACACTTGGAGGAGCTAAGGAACAGGGGCTGAGGCCATCGTCAGCTTTGGA
                      ____________________________________________________________
consensus TAGCTGAGAAACACTTGGAGGAGCTAAGGAACAGGGGCTGAGGCCATCGTCAGCTTTGGA
 
. : . : . : . : . : . :
JMFS046A06+ TTCCACAAGTACAGATTTTCCACATCTGTCGATACGGTGTTGGTCATGCTGTGAACACAT
JMFF038B10+ TTCCACAAGTACAGATTTTCCACATCTGTCGATACGGTGTTGGTCATGCTGTGAACACAT
                      ____________________________________________________________
consensus TTCCACAAGTACAGATTTTCCACATCTGTCGATACGGTGTTGGTCATGCTGTGAACACAT
 
. : . : . : . : . : . :
JMFS046A06+ TTTCCAATACTGAGATGTTTGAAACCAGTCACATATGATAGCTTGTTCAGCAATCTCAAG
JMFF038B10+ TTTCCAATACTGAGATGTTTGAAACCAGTCACATATGATAGCTTGTTCAGCAATCTCAAG
                      ____________________________________________________________
consensus TTTCCAATACTGAGATGTTTGAAACCAGTCACATATGATAGCTTGTTCAGCAATCTCAAG
 
. : . : . : . : . : . :
JMFS046A06+ TGAGAAGTGGGTGAATAGAGCAG
JMFF038B10+ TGAGAAGTGGGTGAATAGAGCAGCTTGAACACATTCAGGTAAAGAATACTGTATCAGCAT
                      ____________________________________________________________
consensus TGAGAAGTGGGTGAATAGAGCAGCTTGAACACATTCAGGTAAAGAATACTGTATCAGCAT
 
. : . : . : . : . : . :
JMFF038B10+ AGCAATAAAACCATGCAGAAAGTCAAAGAATATGCTTTCCCGCCTTTACAAATCAAGACA
                      ____________________________________________________________
consensus AGCAATAAAACCATGCAGAAAGTCAAAGAATATGCTTTCCCGCCTTTACAAATCAAGACA
 
. : . : . : . : . : . :
JMFF038B10+ AAAGATCCACCAACAAAAATGCTTTCACGCTTTAGGAATCAAAATGCACAAGATGATTGG
                      ____________________________________________________________
consensus AAAGATCCACCAACAAAAATGCTTTCACGCTTTAGGAATCAAAATGCACAAGATGATTGG
 
. : . : . : . : . : . :
JMFF038B10+ CCAAGTTACTATAAGATGACCTTTCCCAATCTGCTGACTGATGATGCTAAAACTGTGAAA
                      ____________________________________________________________
consensus CCAAGTTACTATAAGATGACCTTTCCCAATCTGCTGACTGATGATGCTAAAACTGTGAAA
 
. : . : . : . : . : . :
JMFF038B10+ ACCAAGGGCGGGCACTGCTATGGCCAAGGAGAAGGCTCTCTTGGGTCTTCCCCGGAGTGG
                      ____________________________________________________________
consensus ACCAAGGGCGGGCACTGCTATGGCCAAGGAGAAGGCTCTCTTGGGTCTTCCCCGGAGTGG