Previous Contig 001641:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037P10Sequence175001641 (2)
JMFF042C22Sequence628001641 (2)619011091 (5)gb:AY156511_15853915e-39Oryza sativa (japonica cultivar-group) serine/threonine protein kinase (DPK2) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042C22+ AAAAGAAA
                      ____________________________________________________________
consensus AAAAGAAA
 
. : . : . : . : . : . :
JMFF042C22+ AGGAACGTGACAAAAAGCAGACGAGAAAAATATATCTTTTTCACCTAAAATACTATCATT
                      ____________________________________________________________
consensus AGGAACGTGACAAAAAGCAGACGAGAAAAATATATCTTTTTCACCTAAAATACTATCATT
 
. : . : . : . : . : . :
JMFF042C22+ TTACACCCCAAAAAAATGAAAAGACTTGAGAAAACAGCTTTTAGGTAAATTGCCATGAGA
                      ____________________________________________________________
consensus TTACACCCCAAAAAAATGAAAAGACTTGAGAAAACAGCTTTTAGGTAAATTGCCATGAGA
 
. : . : . : . : . : . :
JMFF042C22+ AGACTTAATATAGTAACTTATATCCTCAACCCTTTTAGCTAAATTGCAATTACAGCTTCG
                      ____________________________________________________________
consensus AGACTTAATATAGTAACTTATATCCTCAACCCTTTTAGCTAAATTGCAATTACAGCTTCG
 
. : . : . : . : . : . :
JMFF042C22+ ACTTCAGCTCCCCGTAGAAAAGTTTCAAACTTGAAGTAAATTGGAGAAAAAAGAACCGAA
                      ____________________________________________________________
consensus ACTTCAGCTCCCCGTAGAAAAGTTTCAAACTTGAAGTAAATTGGAGAAAAAAGAACCGAA
 
. : . : . : . : . : . :
JMFF042C22+ AATGAAAAACATCAATACCTCAAGACAAGACCGAGAAAAAAAAAAACCAAAAAAACTCTG
                      ____________________________________________________________
consensus AATGAAAAACATCAATACCTCAAGACAAGACCGAGAAAAAAAAAAACCAAAAAAACTCTG
 
. : . : . : . : . : . :
JMFF042C22+ GAAATACTGAAATTGCAAACAAAAACCACCACAAAACCCCCACAAGTAAGAGGAATCGAA
                      ____________________________________________________________
consensus GAAATACTGAAATTGCAAACAAAAACCACCACAAAACCCCCACAAGTAAGAGGAATCGAA
 
. : . : . : . : . : . :
JMFF042C22+ GTGATCCAGGTTAAAATCGGGAAGAAATGCATAAAAATACCTCGATCGAAGGAGCTTGAC
                      ____________________________________________________________
consensus GTGATCCAGGTTAAAATCGGGAAGAAATGCATAAAAATACCTCGATCGAAGGAGCTTGAC
 
. : . : . : . : . : . :
JMFF042C22+ TTTGCGATTATGACAGTCGGTGCTTACCTTTTTCAGTTCACACGCCGATCGATATCCCAA
                      ____________________________________________________________
consensus TTTGCGATTATGACAGTCGGTGCTTACCTTTTTCAGTTCACACGCCGATCGATATCCCAA
 
. : . : . : . : . : . :
JMFF042C22+ ACGACGACGTTTACCCACCCACCGCACGCCACTTCCACCTCAGCTGAATTATCACGGCTG
JMFF037P10+ GACGTTTACCCACCCACCGCACGCCACTTCCACCTCAGCTGAATTATCACGGNTG
                      ____________________________________________________________
consensus ACGACGACGTTTACCCACCCACCGCACGCCACTTCCACCTCAGCTGAATTATCACGGCTG
 
. : . : . : . : . : . :
JMFF042C22+ CTGCACCGTACCGGCGGGGATGCTAGAGAGAGAGGTAGCAGTCCGAGAAATAGAGAGAGA
JMFF037P10+ CTGCACCGTACCGGCGGGGATGCTAGAGAGAGAGGTAGCAGTCCGAGAAATAGAGAGAGA
                      ____________________________________________________________
consensus CTGCACCGTACCGGCGGGGATGCTAGAGAGAGAGGTAGCAGTCCGAGAAATAGAGAGAGA
 
. : . : . : . : . : . :
JMFF042C22+ AACAGACAGGCAAGGC
JMFF037P10+ AACAGACAGGCAAGGCGAGCAATTGAATGAATGCGTGTCTGTATAGCGCTATAGCAGCAT
                      ____________________________________________________________
consensus AACAGACAGGCAAGGCGAGCAATTGAATGAATGCGTGTCTGTATAGCGCTATAGCAGCAT