Previous Contig 001633:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037K24Sequence278001633 (2)sp|O48561|CAT4_SOYBN3e-32Catalase 4 (EC 1.11.1.6).>gb:AF035255_1762859 Glycine max catalase (cat4) mRNA,
JMSF027L17Sequence575001633 (2)sp|O48561|CAT4_SOYBN6e-92Catalase 4 (EC 1.11.1.6).>gb:AF035255_1762859 Glycine max catalase (cat4) mRNA, 737012493 (4)gb:AC006439_15342912e-73Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027L17+ GGATATGAGACTTGGGATTCGGTTTCAGGGCATGAACC
                      ____________________________________________________________
consensus GGATATGAGACTTGGGATTCGGTTTCAGGGCATGAACC
 
. : . : . : . : . : . :
JMSF027L17+ ATGTCAGGAAACTTCATTCCATCACGGATAAAGAAAACAGGGAAATTGTTACCCACCAAA
                      ____________________________________________________________
consensus ATGTCAGGAAACTTCATTCCATCACGGATAAAGAAAACAGGGAAATTGTTACCCACCAAA
 
. : . : . : . : . : . :
JMSF027L17+ TCAAAGTTACCCTCTCTTGTATAGAACTTTACAGCAAAGCCCCTAGGGTCCCTGAGGGTT
                      ____________________________________________________________
consensus TCAAAGTTACCCTCTCTTGTATAGAACTTTACAGCAAAGCCCCTAGGGTCCCTGAGGGTT
 
. : . : . : . : . : . :
JMSF027L17+ TCTGGGCTTCCTCTTTCATGGATAACTGTGGAAAATCGAACAATAACAGGTGTCTGAACC
                      ____________________________________________________________
consensus TCTGGGCTTCCTCTTTCATGGATAACTGTGGAAAATCGAACAATAACAGGTGTCTGAACC
 
. : . : . : . : . : . :
JMSF027L17+ CCGGGAGCTCTAAGGAAATCAGCACAGGTGAGATGAGAAATATCATGAGTGACCTCAAAA
                      ____________________________________________________________
consensus CCGGGAGCTCTAAGGAAATCAGCACAGGTGAGATGAGAAATATCATGAGTGACCTCAAAA
 
. : . : . : . : . : . :
JMSF027L17+ TAACCCTTGGCACTTGCACCCCTGGCATGCACAACGCGTTNTGGAATCCGTTCACGATCA
JMFF037K24+ CTGGCATGCACAACACGTTCTGGAATCCGTTCACGATCA
                      ____________________________________________________________
consensus TAACCCTTGGCACTTGCACCCCTGGCATGCACAACGCGTTCTGGAATCCGTTCACGATCA
 
. : . : . : . : . : . :
JMSF027L17+ AAATTAGCAAGTTTCTCCACCAAGTGATAATCCTCAATGAGAATTGGCCCTCTGGTTCCG
JMFF037K24+ AAATTAGCAAGTTTCTCCACCAAGTGATAATCCTCAATGAGAATTGGCCCTCTGGTTCCG
                      ____________________________________________________________
consensus AAATTAGCAAGTTTCTCCACCAAGTGATAATCCTCAATGAGAATTGGCCCTCTGGTTCCG
 
. : . : . : . : . : . :
JMSF027L17+ ACGGTCAAGGATGAGTTATTGTTCCAAACTGGAGCACCAGAATTAGTTGTCCAGAAAGGT
JMFF037K24+ ACGGTCAAGGATGAGTTATTGTTCCAAACTGGAGCACCAGAATTAGTTGTCCAGAAAGGT
                      ____________________________________________________________
consensus ACGGTCAAGGATGAGTTATTGTTCCAAACTGGAGCACCAGAATTAGTTGTCCAGAAAGGT
 
. : . : . : . : . : . :
JMSF027L17+ GAATTGAAGGCGCTCGACGGACGGTGCTGGTAAGGATCCATAGAGAAAGTTTCCTCTGTT
JMFF037K24+ GAATTGAAGGCGCTCGACGGACGGTGCTGGTAAGGATCCATAGAGAAAGTTTCCTCTGTT
                      ____________________________________________________________
consensus GAATTGAAGGCGCTCGACGGACGGTGCTGGTAAGGATCCATAGAGAAAGTTTCCTCTGTT
 
. : . : . : . : . : . :
JMSF027L17+ AGCGTAACGTTACGAGAAAACGAAATGCGTACGAAAAGAACAGTCGTATGGTGA
JMFF037K24+ AGCGTAACGTTACGAGAAAACGAAATGCGTACGAAAAG-ACAGTCGTATGGTGAATACTT
                      ____________________________________________________________
consensus AGCGTAACGTTACGAGAAAACGAAATGCGTACGAAAAGAACAGTCGTATGGTGAATACTT