Previous Contig 001631:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037J17Sequence562001631 (4)gb:AP003251_18263070.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044733003267 (2)gb:AY096653_15761891e-66Arabidopsis thaliana putative pumilio/Mpt5 family RNA-binding protein (At2g29190
JMFS023G03Sequence559001631 (4)gb:AP003251_18263070.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044
JMFS038A05Sequence551001631 (4)gb:AP003251_18263075e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044
JMFS137G10Sequence556001631 (4)pir|F84693|F846932e-10hypothetical protein At2g29200 [imported] - Arabidopsis thaliana>gb:AC004561_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS137G10+ TGATAATTCAGTCCGGAAATGATCAAATTGAGACTCG
                      ____________________________________________________________
consensus TGATAATTCAGTCCGGAAATGATCAAATTGAGACTCG
 
. : . : . : . : . : . :
JMFS137G10+ GGAGACTCAATGATAGCATCCACCGCGTGGCTGGCAGGATGAGATGGATGTCTTGAAGTA
                      ____________________________________________________________
consensus GGAGACTCAATGATAGCATCCACCGCGTGGCTGGCAGGATGAGATGGATGTCTTGAAGTA
 
. : . : . : . : . : . :
JMFS137G10+ GGTATCGTGTGGCTTATATCATCCTGAACAATCTCTGCTATGCTCTTCTGCTGACTTCCT
                      ____________________________________________________________
consensus GGTATCGTGTGGCTTATATCATCCTGAACAATCTCTGCTATGCTCTTCTGCTGACTTCCT
 
. : . : . : . : . : . :
JMFS137G10+ AAACCCAGTCCTGGCAATCCAATAAGTCCACTGCCTCCCCAGTCCTTCTGTGCCTCACTT
                      ____________________________________________________________
consensus AAACCCAGTCCTGGCAATCCAATAAGTCCACTGCCTCCCCAGTCCTTCTGTGCCTCACTT
 
. : . : . : . : . : . :
JMFS137G10+ CCATTTTCTAGATTCTTCCCAGAAAATCCCATTCCCATTGAAATTTGGGACGTTTCAACC
                      ____________________________________________________________
consensus CCATTTTCTAGATTCTTCCCAGAAAATCCCATTCCCATTGAAATTTGGGACGTTTCAACC
 
. : . : . : . : . : . :
JMFS137G10+ CCTCTACTCACTTTCCTTCTGTCTCCAATTCCCCCGAGCCTCACGTGACTCCCACTACCG
JMFS038A05+ TGACTCCCACTACCG
                      ____________________________________________________________
consensus CCTCTACTCACTTTCCTTCTGTCTCCAATTCCCCCGAGCCTCACGTGACTCCCACTACCG
 
. : . : . : . : . : . :
JMFS137G10+ CCGCCGCCGCCATTAATACCTCCACCGCCGCCGCCCTGCAGCCTCTGCGCCGACCGCCAG
JMFS038A05+ CCGCCGCCGCCATTAATACCTCCACCGCCGCCGCCCTGCAGCCTTTGCGCCGACCGCCAG
                      ____________________________________________________________
consensus CCGCCGCCGCCATTAATACCTCCACCGCCGCCGCCCTGCAGCCTTTGCGCCGACCGCCAG
 
. : . : . : . : . : . :
JMFS137G10+ TCCTCCTTGGACAAAAGAGGCGGCGGGAGCCGAGGGTTCACGTTCCCGTTAGAATAGTAA
JMFS038A05+ TCCTCCTTGGACAAAAGAGGCGGCGGGAGCCGAGGGTTCACGTTCCCGTTAGAATAGTAA
                      ____________________________________________________________
consensus TCCTCCTTGGACAAAAGAGGCGGCGGGAGCCGAGGGTTCACGTTCCCGTTAGAATAGTAA
 
. : . : . : . : . : . :
JMFS137G10+ TACGAAACATACGCCGCATTAGACCTCATCTCCTCCTCCGAAACTCCATTCAAATCACCG
JMFS038A05+ TACGAAACATACGCCGCATTAGACCTCATCTCCTCCTCCGAAACTCCATTCAAATCACCG
JMFS023G03+ GCATTAGACCTCATCTCCTCCTCCGAAACTCCATTCAAATCACCG
JMFF037J17+ CGAAACTCCATTCAAATCACCG
                      ____________________________________________________________
consensus TACGAAACATACGCCGCATTAGACCTCATCTCCTCCTCCGAAACTCCATTCAAATCACCG
 
. : . : . : . : . : . :
JMFS137G10+ CCGCCGAGAGCCTCCGGCGATCCTTTGATCGTCGGCGGA
JMFS038A05+ CCGCCGAGAGCCTCCGGCGATCCTTTGATCGTCGGCGGAGCTGAGCCACTCCGGAAAATG
JMFS023G03+ CCGCCGAGAGCCTCCGGCGATCCTTTGATCGTCGGCGGAGCTGAGCCACTCCGGAAAATG
JMFF037J17+ CCGCCGAGAGCCTCCGGCGATCCTTTGATCGTCGGCGGAGCTGAGCCACTCCGGAAAATG
                      ____________________________________________________________
consensus CCGCCGAGAGCCTCCGGCGATCCTTTGATCGTCGGCGGAGCTGAGCCACTCCGGAAAATG
 
. : . : . : . : . : . :
JMFS038A05+ CTCAGTTCCCCCTCCCGATTGCCCGCCTCCTCCAGCTGCCTCCTCTGCTCTCTTAGCAGC
JMFS023G03+ CTCAGTTCCCCCTCCCGATTGCCCGCCTCCTCCAGCTGCCTCCTCTGCTCTCTTAGCAGC
JMFF037J17+ CTCAGTTCCCCCTCCCGATTGCCCGCCTCCTCCAGCTGCCTCCTCTGCTCTCTTAGCAGC
                      ____________________________________________________________
consensus CTCAGTTCCCCCTCCCGATTGCCCGCCTCCTCCAGCTGCCTCCTCTGCTCTCTTAGCAGC
 
. : . : . : . : . : . :
JMFS038A05+ ACCTCTAGCTCTTCCCCAAAATCGCTGCTCCCTCCCATCACCGATCGCATTCTCCGATTT
JMFS023G03+ ACCTCTAGCTCTTCCCCAAAATCGCTGCTCCCTCCCATCACCGATCGCATTCTCCGATTT
JMFF037J17+ ACCTCTAGCTCTTCCCCAAAATCGCTGCTCCCTCCCATCACCGATCGCATTCTCCGATTT
                      ____________________________________________________________
consensus ACCTCTAGCTCTTCCCCAAAATCGCTGCTCCCTCCCATCACCGATCGCATTCTCCGATTT
 
. : . : . : . : . : . :
JMFS038A05+ TCATCAGTAATCATTGCAAAAATATACACACACGCGAACTACAAAAAGCATCGACAAACA
JMFS023G03+ TCATCAGTAATCATTGCAAAAATATACACACACGCGAACTACAAAAAGCATCGACAAACA
JMFF037J17+ TCATCAGTAATCATTGCAAAAATATACACACACGCGAACTACAAAAAGCATCGACAAACA
                      ____________________________________________________________
consensus TCATCAGTAATCATTGCAAAAATATACACACACGCGAACTACAAAAAGCATCGACAAACA
 
. : . : . : . : . : . :
JMFS038A05+ TTAAGCTCAGAAAGCAACAATATTAACTTAATTCCCCGTAAGTTCTCTCAGACAACTAAA
JMFS023G03+ TTAAGCTCAGAAAGCAACAATATTAACTTAATTCCCCGTAAGTTCTCTCAGACAACTAAA
JMFF037J17+ TTAAGCTCAGAAAGCAACAATATTAACTTAATTCCCCGTAAGTTCTCTCAGACAACTAAA
                      ____________________________________________________________
consensus TTAAGCTCAGAAAGCAACAATATTAACTTAATTCCCCGTAAGTTCTCTCAGACAACTAAA
 
. : . : . : . : . : . :
JMFS038A05+ AAAAAGGTGGAGAAACTGTTAAAGATTCCATTTTTTTCGCATAAGTTCAAACATT
JMFS023G03+ AAAAAGGTGGAGAAACTGTTAAAGATTCCATTTTTTTCGCATAAGTTCAAACATTTAGCT
JMFF037J17+ AAAAAGGTGGAGAAACTGTTAAAGATTCCATTTTTTTCGCATAAGTTCAAACATTTAGCT
                      ____________________________________________________________
consensus AAAAAGGTGGAGAAACTGTTAAAGATTCCATTTTTTTCGCATAAGTTCAAACATTTAGCT
 
. : . : . : . : . : . :
JMFS023G03+ AAAATTATAGCTCCGACAATGCCATTTTACAGTTGATCGTTATGAGATGGACCATTTTCA
JMFF037J17+ AAAATTATAGCTCCGACAATGCCATTTTACAGTTGATCGTTATGAGATGGACCATTTTCA
                      ____________________________________________________________
consensus AAAATTATAGCTCCGACAATGCCATTTTACAGTTGATCGTTATGAGATGGACCATTTTCA
 
. : . : . : . : . : . :
JMFS023G03+ AGAGAGAGAAAGTGATGAAGTGCAGGGGGATTGATAAGCATGGAGCGTGGAGAGGGTTTT
JMFF037J17+ AGAGAGAGAAAGTGATGAAGTGCAGGGGGATTGATAAGCATGGAGCGTGGAGAGGGTTTT
                      ____________________________________________________________
consensus AGAGAGAGAAAGTGATGAAGTGCAGGGGGATTGATAAGCATGGAGCGTGGAGAGGGTTTT
 
. : . : . : . : . : . :
JMFS023G03+ AGCCGTTGGATGAAGATGTTGACGGCTGAGATTG
JMFF037J17+ AGCCGTTGGATGAAGATGTTGACGGCTGAGATTGAGAGATGATGTAAGATTTGCTCTTAT
                      ____________________________________________________________
consensus AGCCGTTGGATGAAGATGTTGACGGCTGAGATTGAGAGATGATGTAAGATTTGCTCTTAT