Previous Contig 001628:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I23Sequence522001628 (2)gb:AK175212_18172001e-24Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL21-678009951 (2)pir|B84889|B848891e-20hypothetical protein At2g45320 [imported] - Arabidopsis thaliana>gb:AC002387_153
JMFF037I14Sequence523001628 (2)pir|B84889|B848894e-19hypothetical protein At2g45320 [imported] - Arabidopsis thaliana>gb:AC002387_153743009951 (2)pir|B84889|B848897e-30hypothetical protein At2g45320 [imported] - Arabidopsis thaliana>gb:AC002387_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF003I23+ CACCTGAATGAAATTAATAAAGACATCTAAGATGGCAAGTGACCTCTCC
JMFF037I14+ AATGAAATTAATAAAGACATCTAAGATGGCAAGTGACCTCTCC
                      ____________________________________________________________
consensus CACCTGAATGAAATTAATAAAGACATCTAAGATGGCAAGTGACCTCTCC
 
. : . : . : . : . : . :
JMFF003I23+ A-CCTTGCTGTATGAAGCGTTCCCAACAGTAGTAACCAAGTTTACCAATCTTTCATTCCT
JMFF037I14+ ACCCTTGCTGTATGAAGCGTTCCCAACAGTAGTAACCAAGTTTACCAATCTTTCATTCCT
                      ____________________________________________________________
consensus ACCCTTGCTGTATGAAGCGTTCCCAACAGTAGTAACCAAGTTTACCAATCTTTCATTCCT
 
. : . : . : . : . : . :
JMFF003I23+ TTGTGTGTCAACTGGAGCATCATAAGTGGCAAATACAGTGACAAAGGAAACAATATCTCC
JMFF037I14+ TTGTGTGTCAACTGGAGCATCATAAGTGGCAAATACAGTGACAAAGGAAACAATATCTCC
                      ____________________________________________________________
consensus TTGTGTGTCAACTGGAGCATCATAAGTGGCAAATACAGTGACAAAGGAAACAATATCTCC
 
. : . : . : . : . : . :
JMFF003I23+ AGAACCCGAATTGCTAGAAGCTGGGAAGTGTGTTCTGTTGAGGGCCTTGTTACCTCGGCA
JMFF037I14+ AGAACCCGAATTGCTAGAAGCTGGGAAGTGTGTTCTGTTGAGGGCCTTGTTACCTCGGCA
                      ____________________________________________________________
consensus AGAACCCGAATTGCTAGAAGCTGGGAAGTGTGTTCTGTTGAGGGCCTTGTTACCTCGGCA
 
. : . : . : . : . : . :
JMFF003I23+ ATGCAGGCGATCGGGTAAACCTTGACCCGCAGCAGGTCCCAGAACCAGATGATCAAATTT
JMFF037I14+ ATGCAGGCGATCGGGTAAACCTTGACCCGCAGCAGGTCCCAGAACCAGATGATCAAATTT
                      ____________________________________________________________
consensus ATGCAGGCGATCGGGTAAACCTTGACCCGCAGCAGGTCCCAGAACCAGATGATCAAATTT
 
. : . : . : . : . : . :
JMFF003I23+ CTTCTTCTTCAGCTCATTCTGCCCACTCACACGCTGCACGTCTTCAGGAACCTTCCGGCC
JMFF037I14+ CTTCTTCTTCAGCTCATTCTGCCCACTCACACGCTGCACGTCTTCAGGANCCTTCCGGCC
                      ____________________________________________________________
consensus CTTCTTCTTCAGCTCATTCTGCCCACTCACACGCTGCACGTCTTCAGGAACCTTCCGGCC
 
. : . : . : . : . : . :
JMFF003I23+ CTGTTGCTGCAGCTCTAAAACTGAAAGAAGATGAGGCAGAAGGAATAGAAGCGGCAAGAA
JMFF037I14+ CTGTTGCTGCAGCTCTAAAACTGAAAGAAGATGAGGCAGAAGGAATAGAAGCGGCAAGAA
                      ____________________________________________________________
consensus CTGTTGCTGCAGCTCTAAAACTGAAAGAAGATGAGGCAGAAGGAATAGAAGCGGCAAGAA
 
. : . : . : . : . : . :
JMFF003I23+ AAAGAGGAATCGGCGCCACCCGCTGCACACTCTCTTCGTTGACATTCGTCAGAAAGTTGC
JMFF037I14+ AAAGAGGAATCGGCGCCACCCGCTGCACACTCTCTTCGTTGACATTCGTCAGAAAGTTGC
                      ____________________________________________________________
consensus AAAGAGGAATCGGCGCCACCCGCTGCACACTCTCTTCGTTGACATTCGTCAGAAAGTTGC
 
. : . : . : . : . : . :
JMFF003I23+ CGTCTTTGCTATATTCGCCTCCGGCAAGTAGACGACGCTGCTGTTGTGTGAACT
JMFF037I14+ CGTCTTTGCTATATTCGCCTCCGGCAAGTAGACGACGCTGCTGTTGTGTGAACTGATTTC
                      ____________________________________________________________
consensus CGTCTTTGCTATATTCGCCTCCGGCAAGTAGACGACGCTGCTGTTGTGTGAACTGATTTC