Previous Contig 001624:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037G10Sequence555001624 (5)gb:AB025640_15167056e-60Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15663010487 (3)gb:AB025640_15167053e-13Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15
JMFF044G01Sequence626001624 (5)gb:AB025640_15167056e-65Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15586010487 (3)gb:AB025640_15167054e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15
JMFF044P23Sequence628001624 (5)gb:AB025640_15167056e-65Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15623010487 (3)gb:AB025640_15167054e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15
JMFS070G09Sequence642001624 (5)gb:AB025640_15167055e-67Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15
JMFS081A07Sequence629001624 (5)gb:AB025640_15167059e-66Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T12B11.>gb:AY062534_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044P23+ AATCCAAACAGAAAATCCGCGTTCCCTGGCTG
JMFF044G01+ TCCAAACAGAAAATCCGCGTTCCCTGGCTG
                      ____________________________________________________________
consensus AATCCAAACAGAAAATCCGCGTTCCCTGGCTG
 
. : . : . : . : . : . :
JMFF044P23+ CGGCACCACCGCCGAAGCCGAAGGATTTGTCTGAACAGGGCCGGAATTCAACGCTTCCAC
JMFS070G09+ GAAGCCGAAGGATTTGTCTGAACAGGGCCGGAATTCAACGCTTCCAC
JMFS081A07+ GAAGCCGAAGGATTTGTCTGAACAGGGCCGGAATTCAACGCTTCCAC
JMFF044G01+ CGGCACCACCGCCGAAGCCGAAGGATTTGTCTGAACAGGGCCGGAATTCAACGCTTCCAC
JMFF037G10+ ATTCAACGCTTCCAC
                      ____________________________________________________________
consensus CGGCACCACCGCCGAAGCCGAAGGATTTGTCTGAACAGGGCCGGAATTCAACGCTTCCAC
 
. : . : . : . : . : . :
JMFF044P23+ AAACCTATCCTTCTCAGATTTCGCATCATCAGAGCCAAAACTCCGGCTCTGCGATATCAC
JMFS070G09+ AAACCTATCCTTCTCAGATTTCGCATCATCAGAGCCAAAACTCCGGCTCTGCGATATCAC
JMFS081A07+ AAACCTATCCTTCTCAGATTTCGCATCATCAGAGCCAAAACTCCGGCTCTGCGATATCAC
JMFF044G01+ AAACCTATCCTTCTCAGATTTCGCATCATCAGAGCCAAAACTCCGGCTCTGCGATATCAC
JMFF037G10+ AAACCTATCCTTCTCAGATTTCGCATCATCAGAGCCAAAACTCCGGCTCTGCGATATCAC
                      ____________________________________________________________
consensus AAACCTATCCTTCTCAGATTTCGCATCATCAGAGCCAAAACTCCGGCTCTGCGATATCAC
 
. : . : . : . : . : . :
JMFF044P23+ CGTAGGAGGATTAGCCGGGAAGATGAACAGCCTCAACCTAGCCGGCTTCGGCGAAGCCCT
JMFS070G09+ CGTAGGAGGATTAGCCGGGAAGATGAACAGCCTCAACCTAGCCGGCTTCGGCGAAGCCCT
JMFS081A07+ CGTAGGAGGATTAGCCGGGAAGATGAACAGCCTCAACCTAGCCGGCTTCGGCGAAGCCCT
JMFF044G01+ CGTAGGAGGATTAGCCGGGAAGATGAACAGCCTCAACCTAGCCGGCTTCGGCGAAGCCCT
JMFF037G10+ CGTAGGAGGATTAGCCGGGAAGATGAACAGCCTCAACCTAGCCGGCTTCGGCGAAGCCCT
                      ____________________________________________________________
consensus CGTAGGAGGATTAGCCGGGAAGATGAACAGCCTCAACCTAGCCGGCTTCGGCGAAGCCCT
 
. : . : . : . : . : . :
JMFF044P23+ ATAGAGTCGATCGTACTCATGCATCATGTGCTCCAGATCATCGTCGGTGGTGACGGAAAT
JMFS070G09+ ATAGAGTCGATCGTACTCATGCATCATGTGCTCCAGATCATCGTCGGTGGTGACGGAAAT
JMFS081A07+ ATAGAGTCGATCGTACTCATGCATCATGTGCTCCAGATCATCGTCGGTGGTGACGGAAAT
JMFF044G01+ ATAGAGTCGATCGTACTCATGCATCATGTGCTCCAGATCATCGTCGGTGGTGACGGAAAT
JMFF037G10+ ATAGAGTCGATCGTACTCATGCATCATGTGCTCCAGATCATCGTCGGTGGTGACGGAAAT
                      ____________________________________________________________
consensus ATAGAGTCGATCGTACTCATGCATCATGTGCTCCAGATCATCGTCGGTGGTGACGGAAAT
 
. : . : . : . : . : . :
JMFF044P23+ CAGAGCGTCGAGATCTTCTCCGGGGAGCTGGTACTTAAACGACACGGTATCAAAATCACA
JMFS070G09+ CAGAGCGTCGAGATCTTCTCCGGGGAGCTGGTACTTAAACGACACGGTATCAAAATCACA
JMFS081A07+ CAGAGCGTCGAGATCTTCTCCGGGGAGCTGGTACTTAAACGACACGGTATCAAAATCACA
JMFF044G01+ CAGAGCGTCGAGATCTTCTCCGGGGAGCTGGTACTTAAACGACACGGTATCAAAATCACA
JMFF037G10+ CAGAGCGTCGAGATCTTCTCCGGGGAGCTGGTACTTAAACGACACGGTATCAAAATCACA
                      ____________________________________________________________
consensus CAGAGCGTCGAGATCTTCTCCGGGGAGCTGGTACTTAAACGACACGGTATCAAAATCACA
 
. : . : . : . : . : . :
JMFF044P23+ AAGCGAAGCGAGCTTAGAGATAAACTGTGGATACTTAACGTTGCGCTCGACGGAGAGGAT
JMFS070G09+ AAGCGAAGCGAGCTTAGAGATAAACTGTGGATACTTAACGTTGCGCTCGACGGAGAGGAT
JMFS081A07+ AAGCGAAGCGAGCTTAGAGATAAACTGTGGATACTTAACGTTGCGCTCGACGGAGAGGAT
JMFF044G01+ AAGCGAAGCGAGCTTAGAGATAAACTGTGGATACTTAACGTTGCGCTCGACGGAGAGGAT
JMFF037G10+ AAGCGAAGCGAGCTTAGAGATAAACTGTGGATACTTAACGTTGCGCTCGACGGAGAGGAT
                      ____________________________________________________________
consensus AAGCGAAGCGAGCTTAGAGATAAACTGTGGATACTTAACGTTGCGCTCGACGGAGAGGAT
 
. : . : . : . : . : . :
JMFF044P23+ CTTGGTCTCGCCGCCGATGTAAGTGAGCTGGTTGTCGTGCGGGCGGGGGTGGATTTTGCC
JMFS070G09+ CTTGGTCTCGCCGCCGATGTAAGTGAGCTGGTTGTCGTGCGGGCGGGGGTGGATTTTGCC
JMFS081A07+ CTTGGTCTCGCCGCCGATGTAAGTGAGCTGGTTGTCGTGCGGGCGGGGGTGGATTTTGCC
JMFF044G01+ CTTGGTCTCGCCGCCGATGTAAGTGAGCTGGTTGTCGTGCGGGCGGGGGTGGATTTTGCC
JMFF037G10+ CTTGGTCTCGCCGCCGATGTAAGTGAGCTGGTTGTCGTGCGGGCGGGGGTGGATTTTGCC
                      ____________________________________________________________
consensus CTTGGTCTCGCCGCCGATGTAAGTGAGCTGGTTGTCGTGCGGGCGGGGGTGGATTTTGCC
 
. : . : . : . : . : . :
JMFF044P23+ ACCGTAACTGCACATGAATTTGACCTTGTAGTTAGGCGGAAGCGGCTGATTCGGATCCTC
JMFS070G09+ ACCGTAACTGCACATGAATTTGACCTTGTAGTTAGGCGGAAGCGGCTGATTCGGATCCTC
JMFS081A07+ ACCGTAACTGCACATGAATTTGACCTTGTAGTTAGGCGGAAGCGGCTGATTCGGATCCTC
JMFF044G01+ ACCGTAACTGCACATGAATTTGACCTTGTAGTTAGGCGGAAGCGGCTGATTCGGATCCTC
JMFF037G10+ ACCGTAACTGCACATGAATTTGACCTTGTAGTTAGGCGGAAGCGGCTGATTCGGATCCTC
                      ____________________________________________________________
consensus ACCGTAACTGCACATGAATTTGACCTTGTAGTTAGGCGGAAGCGGCTGATTCGGATCCTC
 
. : . : . : . : . : . :
JMFF044P23+ CCACGGCGGATTTTCGAACTCGATTTCACGGGACCGCGGCGAGGAGTCGCCGGACTCCGG
JMFS070G09+ CCACGGCGGATTTTCGAACTCGATTTCACGGGACCGCGGCGAGGAGTCGCCGGACTCCGG
JMFS081A07+ CCACGGCGGATTTTCGAACTCGATTTCACGGGACCGCGGCGAGGAGTCGCCGGACTCCGG
JMFF044G01+ CCACGGCGGATTTTCGAACTCGATTTCACGGGACCGCGGCGAGGAGTCGCCGGACTCCGG
JMFF037G10+ CCACGGCGGATTTTCGAACTCGATTTCACGGGACCGCGGCGAGGAGTCGCCGGACTCCGG
                      ____________________________________________________________
consensus CCACGGCGGATTTTCGAACTCGATTTCACGGGACCGCGGCGAGGAGTCGCCGGACTCCGG
 
. : . : . : . : . : . :
JMFF044P23+ ATAAGAGGTGTACGAGTAGTTCTCCATGGATGGAGGGAGAAGAGTGTGGCTGATCT
JMFS070G09+ ATAAGAGGTGTACGAGTAGTTCTCCATGGATG
JMFS081A07+ ATAAGAGGTGTACGAGTAG
JMFF044G01+ ATAAGAGGTGTACGAGTAGTTCTCCATGGATGGAGGGAGAAGAGTGTGGCTGATCT
JMFF037G10+ ATAAGAGGTGTACGAGTAGTTCTCCATGGATGGAGGGAGAAGAGTGTGGCTGATCTGAGT
                      ____________________________________________________________
consensus ATAAGAGGTGTACGAGTAGTTCTCCATGGATGGAGGGAGAAGAGTGTGGCTGATCTGAGT