Previous Contig 001623:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037G05Sequence573001623 (3)gb:BT000454_16347324e-66Arabidopsis thaliana putative 3-hydroxybutyryl-CoA dehydrogenase (At3g15290) mRN734001623 (3)gb:BT000454_16347329e-64Arabidopsis thaliana putative 3-hydroxybutyryl-CoA dehydrogenase (At3g15290) mRN
JMFN030P11Sequence579001623 (3)gb:BT000454_16347324e-52Arabidopsis thaliana putative 3-hydroxybutyryl-CoA dehydrogenase (At3g15290) mRN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037G05- ATACAGAGTA
                      ____________________________________________________________
consensus ATACAGAGTA
 
. : . : . : . : . : . :
rJMFF037G05- ACTATTTACAGAAGTCTTATAAAAAGTCTCTAAAAATCCATAAACACCAATAAATTTTTT
                      ____________________________________________________________
consensus ACTATTTACAGAAGTCTTATAAAAAGTCTCTAAAAATCCATAAACACCAATAAATTTTTT
 
. : . : . : . : . : . :
JMFN030P11+ AAAATTCTTAAAAGTCTAAATTGATTTTAAAGACTTTCTAAAAATTTGAATCAAATACCC
rJMFF037G05- AAAATTCTTAAAAGTCTAAATTGATTTTAAAGACTTTCTAAAAATTTGAATCAAATACCC
                      ____________________________________________________________
consensus AAAATTCTTAAAAGTCTAAATTGATTTTAAAGACTTTCTAAAAATTTGAATCAAATACCC
 
. : . : . : . : . : . :
JMFN030P11+ CTTGTAGAGTTTATAAAAGTATTTACAAGTCTACATCAAATTCCAAGGGCATGAATGATT
rJMFF037G05- CTTGTAGAGTTTATAAAAGTATTTACAAGTCTACATCAAATTCCAAGGGCATGAATGATT
                      ____________________________________________________________
consensus CTTGTAGAGTTTATAAAAGTATTTACAAGTCTACATCAAATTCCAAGGGCATGAATGATT
 
. : . : . : . : . : . :
JMFN030P11+ TATTTTTTGCCACACTTTCTGCAAATTTCATTCTAGCTCCACAAATTCTTTATTTCTAAG
rJMFF037G05- TATTTTTTGCCACACTTTCTGCAAATTTCATTCTAGCTCCACAAATTCTTTATTTCTAAG
                      ____________________________________________________________
consensus TATTTTTTGCCACACTTTCTGCAAATTTCATTCTAGCTCCACAAATTCTTTATTTCTAAG
 
. : . : . : . : . : . :
JMFN030P11+ CCAGGATGCGAAATTGAACATTTGAAGCAAATGCACCCCAAGAGTTCAAAGTCGTGATGA
rJMFF037G05- CCAGGATGCGAAATTGAACATTTGAAGCAAATGCACCCCAAGAGTTCAAAGTCGTGATGA
                      ____________________________________________________________
consensus CCAGGATGCGAAATTGAACATTTGAAGCAAATGCACCCCAAGAGTTCAAAGTCGTGATGA
 
. : . : . : . : . : . :
JMFN030P11+ AGGGTTTGTGCTACCGGTTGCATTCCGGTAATCATACACACCAATGCCACGTTTTCTGCC
rJMFF037G05- AGGGTTTGTGCTACCGGTTGCATTCCGGTAATCATACACACCAATGCCACGTTTTCTGCC
                      ____________________________________________________________
consensus AGGGTTTGTGCTACCGGTTGCATTCCGGTAATCATACACACCAATGCCACGTTTTCTGCC
 
. : . : . : . : . : . :
JMFN030P11+ AAGTCTGCCTGCATCAACATACTGCACAAGGAGAGGGCATGGAGCATATTTAGTGTCCCC
rJMFF037G05- AAGTCTGCCTGCATCAACATACTGCACAAGGAGAGGGCATGGAGCATATTTAGTGTCCCC
                      ____________________________________________________________
consensus AAGTCTGCCTGCATCAACATACTGCACAAGGAGAGGGCATGGAGCATATTTAGTGTCCCC
 
. : . : . : . : . : . :
JMFN030P11+ CAGGCCGCCATGGAGGACTTTCAAAATTGCCAAGCAAACATCCAACCCGATAAAATCTGC
rJMFF037G05- CAGGCCGCCATGGAGGACTTTCAAAATTGCCAAGCAAACATCCAACCCGATAAAATCTGC
                      ____________________________________________________________
consensus CAGGCCGCCATGGAGGACTTTCAAAATTGCCAAGCAAACATCCAACCCGATAAAATCTGC
 
. : . : . : . : . : . :
JMFN030P11+ GAGTTCCAGAGGACCCATTGGATGGTTCGTTCCAAATTTCATTCCTGCATCAATGTCTTC
rJMFF037G05- GAGTTCCAGAGGACCCATTGGATGGTTCGTTCCAAATTTCATTCCTGCATCAATGTCTTC
                      ____________________________________________________________
consensus GAGTTCCAGAGGACCCATTGGATGGTTCGTTCCAAATTTCATTCCTGCATCAATGTCTTC
 
. : . : . : . : . : . :
JMFN030P11+ CTTAGCCGCGACTCCATTGTAGAGTGTATAAAATGCTTCGTTTATCATTGGCATCAAGAT
rJMFF037G05- CTTAGCCGCGACTCCATTGTAGAGTGTATAAAATGCTTCGTTTATCATTGGCATCAAGAT
                      ____________________________________________________________
consensus CTTAGCCGCGACTCCATTGTAGAGTGTATAAAATGCTTCGTTTATCATTGGCATCAAGAT
 
. : . : . : . : . : . :
JMFN030P11+ TCGATTCACAATAAAGCCAGCGTAATCCTGAGAGCAAAC
rJMFF037G05- TCGATTCACAATAAAGCCAGCGTAATCCTGAGAGCAAACAACTGCCTTGCCAAACCTTTC
JMFF037G05+ CTGAGAGCAAACAACTGCCTTGCCAAACCTTTC
                      ____________________________________________________________
consensus TCGATTCACAATAAAGCCAGCGTAATCCTGAGAGCAAACAACTGCCTTGCCAAACCTTTC
 
. : . : . : . : . : . :
rJMFF037G05- TGCCAAGCTCTTTGTTACATTATATGTCTCATCCGATGTATCTGCACCCCTGATAATTTC
JMFF037G05+ TGCCAAGCTCTTTGTTACATTATATGTCTCATCCGATGTATCTGCACCCCTGATAATTTC
                      ____________________________________________________________
consensus TGCCAAGCTCTTTGTTACATTATATGTCTCATCCGATGTATCTGCACCCCTGATAATTTC
 
. : . : . : . : . : . :
rJMFF037G05- AACC
JMFF037G05+ AACCAGTTTCATAATGGGAGGAGGATTCATAAAATGCATGCCAATCACCTGTGTAGGACG
                      ____________________________________________________________
consensus AACCAGTTTCATAATGGGAGGAGGATTCATAAAATGCATGCCAATCACCTGTGTAGGACG
 
. : . : . : . : . : . :
JMFF037G05+ ATTAGTTGCAGATGCCAAACGGGTAATGGAGATAGAGCTTGTGTTAGAAGCCAAGATTGC
                      ____________________________________________________________
consensus ATTAGTTGCAGATGCCAAACGGGTAATGGAGATAGAGCTTGTGTTAGAAGCCAAGATTGC
 
. : . : . : . : . : . :
JMFF037G05+ AGAGCTCTTCACAATCTTGTCTAAATCAACAAACAGCTTTTTCTTCACAGATTCAGACTC
                      ____________________________________________________________
consensus AGAGCTCTTCACAATCTTGTCTAAATCAACAAACAGCTTTTTCTTCACAGATTCAGACTC
 
. : . : . : . : . : . :
JMFF037G05+ CACAATAGCCTCAATAACAATATCCACAGACTGGAAATCTTCCAAATTCTGTGAACATNT
                      ____________________________________________________________
consensus CACAATAGCCTCAATAACAATATCCACAGACTGGAAATCTTCCAAATTCTGTGAACATNT
 
. : . : . : . : . : . :
JMFF037G05+ TAGACGCCTGATTGCATCACCACCTCGTTCCTCAGAAAGTAGAGCTTTTGAGACGAGGCG
                      ____________________________________________________________
consensus TAGACGCCTGATTGCATCACCACCTCGTTCCTCAGAAAGTAGAGCTTTTGAGACGAGGCG
 
. : . : . : . : . : . :
JMFF037G05+ TTGAATGTTACTAGAGATGGATTTTTGGGCTCTGTTAAGAGCTTCCGCTTCGGTATNGTA
                      ____________________________________________________________
consensus TTGAATGTTACTAGAGATGGATTTTTGGGCTCTGTTAAGAGCTTCCGCTTCGGTATNGTA
 
. : . : . : . : . : . :
JMFF037G05+ AAGGCAAACGTCGACACCGTTCACGGCGGCCAGTTGGGCAATTCCAGAGCCCATTTGGCC
                      ____________________________________________________________
consensus AAGGCAAACGTCGACACCGTTCACGGCGGCCAGTTGGGCAATTCCAGAGCCCATTTGGCC
 
. : . : . : . : . : . :
JMFF037G05+ TGCGCCGACTACCCCGATGCTCCTCACCGTCGCCATAGTCGTCTTCAGAAAGGACTCCCT
                      ____________________________________________________________
consensus TGCGCCGACTACCCCGATGCTCCTCACCGTCGCCATAGTCGTCTTCAGAAAGGACTCCCT