Previous Contig 001608:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003J07Sequence634001608 (20)gb:AY429440_16058431e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.718001608 (20)gb:AY429440_16058432e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFF007N16Sequence532001608 (20)gb:AY429440_16058432e-59Gossypium barbadense fiber protein Fb19 mRNA, partial cds.676001608 (20)gb:AY429440_16058435e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFF017I15Sequence300001608 (20)gb:AY429440_16058433e-29Gossypium barbadense fiber protein Fb19 mRNA, partial cds.262001608 (20)pir|F84918|F849183e-18hypothetical protein At2g47710 [imported] - Arabidopsis thaliana>gb:AC005309_153
JMFF029B03Sequence506001608 (20)gb:AY429440_16058433e-60Gossypium barbadense fiber protein Fb19 mRNA, partial cds.638001608 (20)gb:AY429440_16058431e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFF036N17Sequence573001608 (20)gb:AY429440_16058433e-35Gossypium barbadense fiber protein Fb19 mRNA, partial cds.748001608 (20)gb:AY429440_16058432e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFF041K11Sequence659001608 (20)gb:AY429440_16058434e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.564001608 (20)gb:AY429440_16058435e-56Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFN015N18Sequence560001608 (20)gb:AY429440_16058434e-54Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFN017M14Sequence582001608 (20)gb:AY429440_16058432e-52Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFN019D12Sequence464001608 (20)gb:AY429440_16058436e-62Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFN019J20Sequence587001608 (20)gb:AY429440_16058435e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFS049C05Sequence615001608 (20)gb:AY429440_16058431e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFS060A09Sequence623001608 (20)gb:AY429440_16058431e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMFS137A02Sequence585001608 (20)gb:AY429440_16058431e-61Gossypium barbadense fiber protein Fb19 mRNA, partial cds.
JMSF050E08Sequence710001608 (20)gb:AY429440_16058432e-55Gossypium barbadense fiber protein Fb19 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017M14+ CCAAACATCTTCTATAATATATTAATGTATAAT
JMSF050E08+ ATGTATAAT
rJMFF003J07- ATGTATAAT
                      ____________________________________________________________
consensus CCAAACATCTTCTATAATATATTAATGTATAAT
 
. : . : . : . : . : . :
JMFN017M14+ TCACTAACCCAATCAGCTAACAATTATTTATCAAGTATATTAAAGCTAAGCAAGCCTTTA
JMSF050E08+ TCACTAACCCAATCAGCTAACAATTATTTATCAAGTATATTAAAGCTAAGCAAGCCTTTA
rJMFF041K11- ATCAAGTATATTAAAGCTAAGCAAGCCTTTA
JMFN015N18+ AACAATTATTTATCAAGTATATTAAAGCTAAGCAAGCCTTTA
rJMFF003J07- TCACTAACCCAATCAGCTAACAATTATTTATCAAGTATATTAAAGCTAAGCAAGCCTTTA
rJMFF007N16- CAAGCCTTTA
rJMFF036N17- AAGCTAAGCAAGCCTTTA
                      ____________________________________________________________
consensus TCACTAACCCAATCAGCTAACAATTATTTATCAAGTATATTAAAGCTAAGCAAGCCTTTA
 
. : . : . : . : . : . :
JMFN017M14+ TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
JMSF050E08+ TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
rJMFF041K11- TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
rJMFF017I15- TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
JMFN015N18+ TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
rJMFF003J07- TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
rJMFF007N16- TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
JMFF041K11+ ACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
rJMFF029B03- TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
JMFF003J07+ ACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
JMFS060A09+ CTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGNCAATGGTT
JMFS049C05+ CTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
JMFS137A02+ ATAGATAGACAGCCAGACAATGGTT
JMFN019J20+ CAGACAATGGTT
rJMFF036N17- TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
                      ____________________________________________________________
consensus TTCTCTGACGTTGATACATACACCAAGCAATTCACATAGATAGACAGACAGACAATGGTT
 
. : . : . : . : . : . :
JMFN017M14+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMSF050E08+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
rJMFF041K11- TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
rJMFF017I15- TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMFN015N18+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
rJMFF003J07- TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
rJMFF007N16- TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMFF041K11+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
rJMFF029B03- TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMFN019D12+ GT
JMFF003J07+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMFS060A09+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMFS049C05+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMFS137A02+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
JMFN019J20+ TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
rJMFF036N17- TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
                      ____________________________________________________________
consensus TATGTAGTCTGGAACATAAATTCTGGACTCATCTGGGCAGATGATGTTTGCAGCTTAAGT
 
. : . : . : . : . : . :
JMFN017M14+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMSF050E08+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCG-AGTAGTC
rJMFF041K11- TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
rJMFF017I15- TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFN015N18+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
rJMFF003J07- TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
rJMFF007N16- TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFF041K11+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
rJMFF029B03- TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFN019D12+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFF003J07+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFS060A09+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFS049C05+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFS137A02+ TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFN019J20+ TTTGTGCTTGGGCTTCTTCACGAGCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFF007N16+ TCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
JMFF029B03+ GCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
rJMFF036N17- TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
                      ____________________________________________________________
consensus TTTGTGCTTGGGCTTCTTCACGATCATGACAGTGCAGTGAGCATGATGAGCGCAGTAGTC
 
. : . : . : . : . : . :
JMFN017M14+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMSF050E08+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
rJMFF041K11- GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
rJMFF017I15- GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFN015N18+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
rJMFF003J07- GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
rJMFF007N16- GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFF041K11+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
rJMFF029B03- GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFN019D12+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFF003J07+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFS060A09+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFS049C05+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFS137A02+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFN019J20+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFF007N16+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
JMFF029B03+ GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
rJMFF036N17- GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
                      ____________________________________________________________
consensus GCTTACACTGCCCAGAACAGCCCTCTTGATAGCTCCATAGCCATGGCTGCCGACAACCAA
 
. : . : . : . : . : . :
JMFN017M14+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMSF050E08+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
rJMFF041K11- GATAGAGGCATGGTATTTCTTCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
rJMFF017I15- GATAGAGGCATGGTATTTCTCC
JMFN015N18+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
rJMFF003J07- GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
rJMFF007N16- GATAGAGGCATGGTATTTCTTCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFF041K11+ GATAGAGGCATGGTATTTCTTCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
rJMFF029B03- GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFN019D12+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFF003J07+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFS060A09+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFS049C05+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFS137A02+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFN019J20+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFF007N16+ GATAGAGGCATGGTATTTCTTCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFF029B03+ GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
rJMFF036N17- GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
JMFF036N17+ GTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
                      ____________________________________________________________
consensus GATAGAGGCATGGTATTTCTCCACAGTTTCACAGAGGACATTCCTGGCATCCCCTTCCAT
 
. : . : . : . : . : . :
JMFN017M14+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMSF050E08+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
rJMFF041K11- GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFN015N18+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
rJMFF003J07- GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
rJMFF007N16- GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFF041K11+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
rJMFF029B03- GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFN019D12+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFF017I15+ CATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFF003J07+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFS060A09+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFS049C05+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFS137A02+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFN019J20+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFF007N16+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFF029B03+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
rJMFF036N17- GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
JMFF036N17+ GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
                      ____________________________________________________________
consensus GATCTCGACCATGGGGTCATCAACCGATTTAGAGGCGCAGATTTCCTTGGCCTGTTCAAT
 
. : . : . : . : . : . :
JMFN017M14+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMSF050E08+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
rJMFF041K11- TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFN015N18+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
rJMFF003J07- TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
rJMFF007N16- TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFF041K11+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
rJMFF029B03- TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFN019D12+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFF017I15+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFF003J07+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFS060A09+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFS049C05+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFS137A02+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFN019J20+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFF007N16+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFF029B03+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
rJMFF036N17- TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
JMFF036N17+ TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
                      ____________________________________________________________
consensus TACCCGCGCAGCAATCTTCTTCAAGTCCGAATCCACGTACGGCAAGACATCAGCAGCGCC
 
. : . : . : . : . : . :
JMFN017M14+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMSF050E08+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
rJMFF041K11- GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFN015N18+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
rJMFF003J07- GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
rJMFF007N16- GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFF041K11+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
rJMFF029B03- GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFN019D12+ GGGGCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFF017I15+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFF003J07+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFS060A09+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFS049C05+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFS137A02+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFN019J20+ GGGCCCGGCGAGGCCGACGGCGGTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFF007N16+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFF029B03+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
rJMFF036N17- GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
JMFF036N17+ GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
                      ____________________________________________________________
consensus GGGCCCGGCGAGGCCGACGGCGCTAGCCGGAGAAGGCTTGGCGTGGACGAGGACAAGCCT
 
. : . : . : . : . : . :
JMFN017M14+ GAAAGGCGA
JMSF050E08+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
rJMFF041K11- GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCAT
JMFN015N18+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAG
rJMFF003J07- GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
rJMFF007N16- GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFF041K11+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
rJMFF029B03- GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFN019D12+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFF017I15+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFF003J07+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFS060A09+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFS049C05+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFS137A02+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFN019J20+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFF007N16+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFF029B03+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
rJMFF036N17- GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
JMFF036N17+ GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
                      ____________________________________________________________
consensus GAAAGGCGACACGGGGCCGGTGAAGAAGTGATCTAAAGTCCATTCCAGAGCATAGAAGCT
 
. : . : . : . : . : . :
JMSF050E08+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
rJMFF003J07- ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
rJMFF007N16- ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFF041K11+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
rJMFF029B03- ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGACATTCT
JMFN019D12+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTT
JMFF017I15+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFF003J07+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFS060A09+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFS049C05+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFS137A02+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFN019J20+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFF007N16+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFF029B03+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGACATTCT
rJMFF036N17- ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
JMFF036N17+ ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
                      ____________________________________________________________
consensus ATGTTCGCTGTCGTCAACTGCAACCACCATAACCGGTTTCTCCGCCGCCGCCGCCATTCT
 
. : . : . : . : . : . :
JMSF050E08+ CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATATATGT
rJMFF003J07- CAAGAGTCCGGGTGATGTCTTTGGGATCGGAGGATATACATGT
rJMFF007N16- CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATATATGTAGATAGTTTGAGAAGTC
JMFF041K11+ CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATATATGTAGATAGTTTGAGAAGTC
rJMFF029B03- CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGG
JMFF017I15+ CAAGAGTCC
JMFF003J07+ CAAGAGTCC-GGTGATGTCTTT-GGATCGGAGGATATACATGT
JMFS060A09+ CAAGAGTCC-GGTGATGTTTTT-GGATCG
JMFS049C05+ CAAGAGTCC-GGTGATGTTT
JMFS137A02+ CAAGAGTCC-GGTGATGTTTT
JMFN019J20+ CAAGAGTCC-GGTGATGTTTTT-G
JMFF007N16+ CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATATATGTAGATAGTTTGAGAAGTC
JMFF029B03+ CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATAT
rJMFF036N17- CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATATATGTAGATAGTTTGAGAAGTC
JMFF036N17+ CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATATATGTAGATAGTTTGAGAAGTC
                      ____________________________________________________________
consensus CAAGAGTCC-GGTGATGTTTTT-GGATCGGAGGATATATATGTAGATAGTTTGAGAAGTC
 
. : . : . : . : . : . :
rJMFF007N16- AACAATTT
JMFF041K11+ AACAATTT
JMFF007N16+ AACAATTT
rJMFF036N17- AACAATTTATTTATAGCACACACAAAAGGGTGTTCTAGTATGATCCAAAGCACAGAAACN
JMFF036N17+ AACAATTTATTTATAGCACACACAAAAGGGTGTTCTAGTATGATCCAAAGCACAGAAACA
                      ____________________________________________________________
consensus AACAATTTATTTATAGCACACACAAAAGGGTGTTCTAGTATGATCCAAAGCACAGAAACA
 
. : . : . : . : . : . :
rJMFF036N17- ACGTGTGATCAG
JMFF036N17+ ACGTGTGATCAGAAACAGTGAGACAGGGAAGAGAACTTGATTCGCTGGCAGATCAGAAGA
                      ____________________________________________________________
consensus ACGTGTGATCAGAAACAGTGAGACAGGGAAGAGAACTTGATTCGCTGGCAGATCAGAAGA
 
. : . : . : . : . : . :
JMFF036N17+ ATAGTTTTGACAGGTAACAACAGTAACGACAGAAACCCGACTTTCTGAAGAAGATCAGAT
                      ____________________________________________________________
consensus ATAGTTTTGACAGGTAACAACAGTAACGACAGAAACCCGACTTTCTGAAGAAGATCAGAT