Previous Contig 001595:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036I11Sequence535001595 (2)gb:AP003842_18340881e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ16745009913 (3)gb:AP005869_18593342e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B102
JMFF050F10Sequence642001595 (2)gb:AY088598_15736144e-73Arabidopsis thaliana clone 8256 mRNA, complete sequence.639021897gb:AP005869_18593346e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B102

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050F10+ CTGCCAACTTCAGAATCTAGCAAGTACTTGAGATTNAGGCCCATGTCCGAGGCGG
                      ____________________________________________________________
consensus CTGCCAACTTCAGAATCTAGCAAGTACTTGAGATTNAGGCCCATGTCCGAGGCGG
 
. : . : . : . : . : . :
JMFF050F10+ GAATAGAAATGCTATATTGTTTGNGCCCTTCAACCCGAGTTCTGACAACTCCTACAGTAC
                      ____________________________________________________________
consensus GAATAGAAATGCTATATTGTTTGNGCCCTTCAACCCGAGTTCTGACAACTCCTACAGTAC
 
. : . : . : . : . : . :
JMFF050F10+ AATGCATTGAGAGGCAATCATCCTTAATATAGTCAGAGGCTTCTAAATTTGCTCGCTTGA
                      ____________________________________________________________
consensus AATGCATTGAGAGGCAATCATCCTTAATATAGTCAGAGGCTTCTAAATTTGCTCGCTTGA
 
. : . : . : . : . : . :
JMFF050F10+ AAAATCTCTTGTAACCCCACATGCTTCCTTTGTATTTCAAAGTATAAGGCCCGCTCTCGA
                      ____________________________________________________________
consensus AAAATCTCTTGTAACCCCACATGCTTCCTTTGTATTTCAAAGTATAAGGCCCGCTCTCGA
 
. : . : . : . : . : . :
JMFF050F10+ GGGCCCGATCGAAATGGGAGTGCACTTTGTGCTTCCCTTTCCCGCTCTGATCCATCAAGG
JMFF036I11+ CGATCGAAATGGGAGTGCACTTTGTGCTTCCCTTTCCCGCTCTGATCCATCAAGG
                      ____________________________________________________________
consensus GGGCCCGATCGAAATGGGAGTGCACTTTGTGCTTCCCTTTCCCGCTCTGATCCATCAAGG
 
. : . : . : . : . : . :
JMFF050F10+ TGAGCTCAAACAAGGCCCTGAGGTCGGTGCCTTCGCTGGCGAGCGCGATGAAAACGGAAA
JMFF036I11+ TGAGCTCAAACAAGGCCCTGACGTCGGTGCCTTCGCTGGCGAGCGCGATGAAAACGGAAA
                      ____________________________________________________________
consensus TGAGCTCAAACAAGGCCCTGAGGTCGGTGCCTTCGCTGGCGAGCGCGATGAAAACGGAAA
 
. : . : . : . : . : . :
JMFF050F10+ CGTAGATGGAGGAATCCTCGACGTTCTTGCCGTCGGGGTAAAAGTAGACGGCCCAATCGT
JMFF036I11+ CGTAGATGGAGGAATCCTCGACGTTCTTGCCGTCGGGGTAAAAGTAGACGGCCCAATCGT
                      ____________________________________________________________
consensus CGTAGATGGAGGAATCCTCGACGTTCTTGCCGTCGGGGTAAAAGTAGACGGCCCAATCGT
 
. : . : . : . : . : . :
JMFF050F10+ AGCCGCCGACGGAGAAGGTATCGCTGGAGATGTACTTGCCAGGACCCATGCCCTTGGCCA
JMFF036I11+ AGCCGCCGACGGAGAAGGTATCGCTGGAGATGTACTTGCCAGGACCCATGCCCTTGGCCA
                      ____________________________________________________________
consensus AGCCGCCGACGGAGAAGGTATCGCTGGAGATGTACTTGCCAGGACCCATGCCCTTGGCCA
 
. : . : . : . : . : . :
JMFF050F10+ GAGAGTAACCCCGGATGGTGAATTTGTGGGAGGCATTCACCGTCTCGTTGATCGACCTCG
JMFF036I11+ GAGAGTAACCCCGGATGGTGAATTTGTGGGAGGCATTCACCGTCTCGTTGATCGACCTCG
                      ____________________________________________________________
consensus GAGAGTAACCCCGGATGGTGAATTTGTGGGAGGCATTCACCGTCTCGTTGATCGACCTCG
 
. : . : . : . : . : . :
JMFF050F10+ AGCAGGAGTCCTGGTGATTCACGGCCATATCATCGGCCGGAAATCCAGACAGAAGGGAAA
JMFF036I11+ AGCAGGAGTCCTGGTGATTCACGGCCATATCACCGGCCGGAAATCCAGACAGAAGGGAAA
                      ____________________________________________________________
consensus AGCAGGAGTCCTGGTGATTCACGGCCATATCATCGGCCGGAAATCCAGACAGAAGGGAAA
 
. : . : . : . : . : . :
JMFF050F10+ CCGCAGACGATAGAATTAGGAGAATTGGAGGAAGAAGCAGTAGTGGT
JMFF036I11+ CCGCAGACGATAGAATTAGGAGAATTGGAGGAAGAAGCAGTAGTGGTAGGGGGGGAATGG
                      ____________________________________________________________
consensus CCGCAGACGATAGAATTAGGAGAATTGGAGGAAGAAGCAGTAGTGGTAGGGGGGGAATGG
 
. : . : . : . : . : . :
JMFF036I11+ GGGCGGGCGAAGGGTTTGTATGTCGGAGGAGAAACGAGAGGAGGAGAAAAGTGGTGGTGG
                      ____________________________________________________________
consensus GGGCGGGCGAAGGGTTTGTATGTCGGAGGAGAAACGAGAGGAGGAGAAAAGTGGTGGTGG
 
. : . : . : . : . : . :
JMFF036I11+ TGGTGGTGGCGGCGGCGATTGGCGAAGGAGAGCAACGGTGAGCGGTGATTGGATGTAATT
                      ____________________________________________________________
consensus TGGTGGTGGCGGCGGCGATTGGCGAAGGAGAGCAACGGTGAGCGGTGATTGGATGTAATT