Previous Contig 001593:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036F16Sequence591001593 (4)gb:AY528721_16117693e-29Triticum aestivum S-like RNase (WRN3) mRNA, partial cds.674001593 (4)gb:AY517470_16107562e-21Triticum aestivum S-like RNase (WRN2) mRNA, complete cds.
JMFN009L11Sequence618001593 (4)gb:AY528721_16117695e-31Triticum aestivum S-like RNase (WRN3) mRNA, partial cds.
JMFN019G17Sequence619001593 (4)gb:AY528721_16117695e-31Triticum aestivum S-like RNase (WRN3) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF036F16- CCTTGCTGTACATACATGCATCACTTATTATTTTCTTAATTATAGGGAATACATGCAAAG
                      ____________________________________________________________
consensus CCTTGCTGTACATACATGCATCACTTATTATTTTCTTAATTATAGGGAATACATGCAAAG
 
. : . : . : . : . : . :
rJMFF036F16- TACAAGTTTAAGTAGTACAGCATATTTAATTAATTCAAACTTTGCTCTAGCCGAATATTG
                      ____________________________________________________________
consensus TACAAGTTTAAGTAGTACAGCATATTTAATTAATTCAAACTTTGCTCTAGCCGAATATTG
 
. : . : . : . : . : . :
rJMFF036F16- GGAGTATTCAATTCCCTTATTCAAAGCTCACTCACTCAATTACCATCTTTAATAGGGGAA
                      ____________________________________________________________
consensus GGAGTATTCAATTCCCTTATTCAAAGCTCACTCACTCAATTACCATCTTTAATAGGGGAA
 
. : . : . : . : . : . :
rJMFF036F16- TTTGACATTATTCCCATTTGTACTGTCGCAAATCCNAAAGGAATGCCCAGGACATTTGAT
                      ____________________________________________________________
consensus TTTGACATTATTCCCATTTGTACTGTCGCAAATCCNAAAGGAATGCCCAGGACATTTGAT
 
. : . : . : . : . : . :
rJMFF036F16- CTTCTTACCCTTGTTGCTAGCACNAAATGTAATGTAATCCAAAACAGCGTTCACTCCCTT
JMFN009L11+ AAATGTAATGTAATCCAAAACAGCGTTCACTCCCTN
JMFN019G17+ AAATGTAATGTAATCCAAAACAGCGTTCACTCCCTT
                      ____________________________________________________________
consensus CTTCTTACCCTTGTTGCTAGCACNAAATGTAATGTAATCCAAAACAGCGTTCACTCCCTT
 
. : . : . : . : . : . :
rJMFF036F16- TTCGTCTTCTCGACATGATACCGTTATTTCACCTAATCCAGCTTTTGCTATAGCTTTATT
JMFN009L11+ TTCGTCTTCTCGACATGATACCGTTATTTCACCTAATCCAGCTTTTGCTATAGCTTTATT
JMFN019G17+ TTCGTCTTCTCGACATGATACCGTTATTTCACCTAATCCAGCTTTTGCTATAGCTTTATT
JMFF036F16+ TCGACATGATACCGTTATTTCACCTAATCCAGCTTTTGCTATAGCTTTATT
                      ____________________________________________________________
consensus TTCGTCTTCTCGACATGATACCGTTATTTCACCTAATCCAGCTTTTGCTATAGCTTTATT
 
. : . : . : . : . : . :
rJMFF036F16- GATTGCATCTCCCGGGTAATATTTACCATTCGGTTTAATTCCTGCATCANCTAGAAGTTT
JMFN009L11+ GATTGCATCTCCCGGGTAATATTTACCATTCGGTTTAATTCCTGCATCAGCTAGAAGTTT
JMFN019G17+ GATTGCATCTCCCGGGTAATATTTACCATTCGGTTTAATTCCTGCATCAGCTAGAAGTTT
JMFF036F16+ GATTGCATCTCCCGGGTAATATTTACCATTCGGTTTAATTCCTGCATCAGCTAGAAGTTT
                      ____________________________________________________________
consensus GATTGCATCTCCCGGGTAATATTTACCATTCGGTTTAATTCCTGCATCAGCTAGAAGTTT
 
. : . : . : . : . : . :
rJMFF036F16- GAGGAGATTAATTTGTTTGTAGACTCTGAGAGCAGCTGCAAAGTAATCATGCTGATTGAA
JMFN009L11+ GAGGAGATTAATTTGTTTGTAGACTCTGAGAGCAGCTGCAAAGTAATCATGCTGATTGAA
JMFN019G17+ GAGGAGATTAATTTGTTTGTAGACTCTGAGAGCAGCTGCAAAGTAATCATGCTGATTGAA
JMFF036F16+ GAGGAGATTAATTTGTTTGTAGACTCTGAGAGCAGCTGCAAAGTAATCATGCTGATTGAA
                      ____________________________________________________________
consensus GAGGAGATTAATTTGTTTGTAGACTCTGAGAGCAGCTGCAAAGTAATCATGCTGATTGAA
 
. : . : . : . : . : . :
rJMFF036F16- TACTGTTTCAGCACAAGTACCGTACTCCACCCATTCTTCCTTCCACAACTTCTTGCTATC
JMFN009L11+ TACTGTTTCAGCACAAGTACCGTACTCCACCCATTCTTCCTTCCACAACTTCTTGCTATC
JMFN019G17+ TACTGTTTCAGCACAAGTACCGTACTCCACCCATTCTTCCTTCCACAACTTCTTGCTATC
JMFF036F16+ TACTGTTTCAGCACAAGTACCGTACTCCACCCATTCTTCCTTCCACAACTTCTTGCTATC
                      ____________________________________________________________
consensus TACTGTTTCAGCACAAGTACCGTACTCCACCCATTCTTCCTTCCACAACTTCTTGCTATC
 
. : . : . : . : . : . :
rJMFF036F16- TCTACTGGGACAACTCANTGAGGGNCAATACTTTTGCAAACTCGGCACTAAATCTGCAAT
JMFN009L11+ TCTACTGGGACAACTCAATGAGGGCCAATACTTTTGCAAACTCGGCACTAAATCTGCAAT
JMFN019G17+ TCTACTGGGACAACTCAATGAGGGCCAATACTTTTGCAAACTCGGCACTAAATCTGCAAT
JMFF036F16+ TCTACTGGGACAACTCAATGAGGGCCAATACTTTTGCAAACTCGGCACTAAATCTGCAAT
                      ____________________________________________________________
consensus TCTACTGGGACAACTCAATGAGGGCCAATACTTTTGCAAACTCGGCACTAAATCTGCAAT
 
. : . : . : . : . : . :
rJMFF036F16- CTTTGACGGATGGAATTTGGTTCCGGTTGTGCAATTTGCGTTTGTCCCTCCATTACTAGA
JMFN009L11+ CTTTGACGGTTGGAATTTGGTTCCGGTTGTGCAATTTGCGTTTGTCCCTCCATTACTAGA
JMFN019G17+ CTTTGACGGTTGGAATTTGGTTCCGGTTGTGCAATTTGCGTTTGTCCCTCCATTACTAGA
JMFF036F16+ CTTTGACGGTTGGAATTTGGTTCCGGTTGTGCAATTTGCGTTTGTCCCTCCATTACTAGA
                      ____________________________________________________________
consensus CTTTGACGGTTGGAATTTGGTTCCGGTTGTGCAATTTGCGTTTGTCCCTCCATTACTAGA
 
. : . : . : . : . : . :
rJMFF036F16- GTAAAATGCTTGAA
JMFN009L11+ GTAAAATGCTTGAAATTCATGAATGACAAAGTCATTCAAAGAAGGGCTTCCTTTCTTTGG
JMFN019G17+ GTAAAATGCTTGAAATTCATGAATGACAAAGTCATTCAAAGAAGGGCTTCCTTTCTTTGG
JMFF036F16+ GTAAAATGCTTGAAATTCATGAATGACAAAGTCATTCAAAGAAGGGCTTCCTTTCTTTGG
                      ____________________________________________________________
consensus GTAAAATGCTTGAAATTCATGAATGACAAAGTCATTCAAAGAAGGGCTTCCTTTCTTTGG
 
. : . : . : . : . : . :
JMFN009L11+ GAGGCAACACCCTTCCTTGCTCTGACACTGGGTCTTTGGCCATTTGAGACTGATGAAAAA
JMFN019G17+ GAGGCAACACCCTTCCTTGCTCTGACACTGGGTCTTTGGCCATTTGAGACTGATGAAAAA
JMFF036F16+ GAGGCAACACCCTTCCTTGCTCTGACACTGGGTCTTTGGCCATTTGAGACTGATGAAAAA
                      ____________________________________________________________
consensus GAGGCAACACCCTTCCTTGCTCTGACACTGGGTCTTTGGCCATTTGAGACTGATGAAAAA
 
. : . : . : . : . : . :
JMFN009L11+ GTAATCAGGTTTGATATCAGCGGTATAGGCTATAGTAGAAAGGGATGCCAAAGAGAGTGT
JMFN019G17+ GTAATCAGGTTTGATATCAGCGGTATAGGCTATAGTAGAAAGGGATGCCAAAGAGAGTGT
JMFF036F16+ GTAATCAGGTTTGATATCAGCGGTATAGGCTATAGTAGAAAGGGATGCCAAAGAGAGTGT
                      ____________________________________________________________
consensus GTAATCAGGTTTGATATCAGCGGTATAGGCTATAGTAGAAAGGGATGCCAAAGAGAGTGT
 
. : . : . : . : . : . :
JMFN009L11+ AGTTAGAAGAAGAAAACAGTGGAAAAGCTTCATGCTTCTTA
JMFN019G17+ AGTTAGAAGAAGAAAACAGT-GAAAAGCTTCATGCTTCTTA
JMFF036F16+ AGTTAGAAGAAGAAAACAGTGGAAAAGCTTCATGCTTCTTAGCTGCTATGCTAACTAGGT
                      ____________________________________________________________
consensus AGTTAGAAGAAGAAAACAGTGGAAAAGCTTCATGCTTCTTAGCTGCTATGCTAACTAGGT