Previous Contig 001591:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036E24Sequence499001591 (2)gb:AC137608_17434793e-24Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009C07, complet721009900 (2)pir|T01729|T017292e-58mitochondrial solute carrier protein homolog - Arabidopsis thaliana>gb:ATCHRIV3_
JMSF037D16Sequence692001591 (2)gb:AC137608_17434793e-67Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009C07, complet785009900 (2)pir|T01729|T017294e-76mitochondrial solute carrier protein homolog - Arabidopsis thaliana>gb:ATCHRIV3_

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037D16+ TCG
                      ____________________________________________________________
consensus TCG
 
. : . : . : . : . : . :
JMSF037D16+ GACCATGTCCATNGGGTATGTTGCAGACATGGCAATTATGCCAGCACAAGCTCCAGCACC
                      ____________________________________________________________
consensus GACCATGTCCATNGGGTATGTTGCAGACATGGCAATTATGCCAGCACAAGCTCCAGCACC
 
. : . : . : . : . : . :
JMSF037D16+ AAGACGCAACAGAGGAGTGAGCTGAGCATCCTCATTGCCAGTTTGCTCGCGGTATAGCCA
                      ____________________________________________________________
consensus AAGACGCAACAGAGGAGTGAGCTGAGCATCCTCATTGCCAGTTTGCTCGCGGTATAGCCA
 
. : . : . : . : . : . :
JMSF037D16+ TAATATACCCTTGGAGGCTTGCTCATAGCTGAAGAACTTGACAGCTGAGTTTGGGACAAT
                      ____________________________________________________________
consensus TAATATACCCTTGGAGGCTTGCTCATAGCTGAAGAACTTGACAGCTGAGTTTGGGACAAT
 
. : . : . : . : . : . :
JMSF037D16+ TCGGGCACAATTGGTGCCATTACCTTTGAATAATCCTCTGAAGCCTTCAGTTTTCCAGAT
JMFF036E24+ AGCCTTCAGTTTTCCAGAT
                      ____________________________________________________________
consensus TCGGGCACAATTGGTGCCATTACCTTTGAATAATCCTCTGAAGCCTTCAGTTTTCCAGAT
 
. : . : . : . : . : . :
JMSF037D16+ ATACTTCAGGCCTTGAACTGTACCATTGTATTTTATATTATGCGGATTTTGTACCTGTAG
JMFF036E24+ ATACTTCAGGCCTTGAACTGTACCATTGTATTTTATATTATGCGGATTTTGTACCTGTAG
                      ____________________________________________________________
consensus ATACTTCAGGCCTTGAACTGTACCATTGTATTTTATATTATGCGGATTTTGTACCTGTAG
 
. : . : . : . : . : . :
JMSF037D16+ TAATATCTTTAAACGCTCTAAAGGAGCAACAGCTGTTCGTGACACGCCGCCGGCAACACC
JMFF036E24+ TAATATCTTTAAACGCTCTAAAGGAGCAACAGCTGTTCGTGACACGCCGCCGGCAACACC
                      ____________________________________________________________
consensus TAATATCTTTAAACGCTCTAAAGGAGCAACAGCTGTTCGTGACACGCCGCCGGCAACACC
 
. : . : . : . : . : . :
JMSF037D16+ TCCAGCAACGAGAGACTTGCATATACTGAGAAGCGCATGGCTTGTGGGCTTAATTTCATC
JMFF036E24+ TCCAGCAACGAGAGACTTGCATATACTGAGAAGCGCATGGCTTGTGGGCTTAATTTCATC
                      ____________________________________________________________
consensus TCCAGCAACGAGAGACTTGCATATACTGAGAAGCGCATGGCTTGTGGGCTTAATTTCATC
 
. : . : . : . : . : . :
JMSF037D16+ TCTAGCGAGCTTCGCCTCCTCGGCAAGGTTCACAATCTTCTCCACAGCCAACTCACCCGT
JMFF036E24+ TCTAGCGAGCTTCGCCTCCTCGGCAAGGTTCACAATCTTCTCCACAGCCAACTCACCCGT
                      ____________________________________________________________
consensus TCTAGCGAGCTTCGCCTCCTCGGCAAGGTTCACAATCTTCTCCACAGCCAACTCACCCGT
 
. : . : . : . : . : . :
JMSF037D16+ CTTCACCTCCTCCGAAGCCAT
JMFF036E24+ CTTCACCTCCTCCGAAGCCATTGAAAGAAATAGACTGTTGTTTAACAGACAAAAAAGAAA
                      ____________________________________________________________
consensus CTTCACCTCCTCCGAAGCCATTGAAAGAAATAGACTGTTGTTTAACAGACAAAAAAGAAA
 
. : . : . : . : . : . :
JMFF036E24+ AGGTCGAATAAGTCAAAAGCTCAGCCGATCAGACTGTCGATATCGATTCCTCGAGAGGAT
                      ____________________________________________________________
consensus AGGTCGAATAAGTCAAAAGCTCAGCCGATCAGACTGTCGATATCGATTCCTCGAGAGGAT
 
. : . : . : . : . : . :
JMFF036E24+ CGATGGCGATCCAGCAATTTATGTATGAGTCTCTATTCACGGCGGCTCGGTAGTTTATTT
                      ____________________________________________________________
consensus CGATGGCGATCCAGCAATTTATGTATGAGTCTCTATTCACGGCGGCTCGGTAGTTTATTT
 
. : . : . : . : . : . :
JMFF036E24+ CGACGAAGAGAGAGCATATGATGCGGCAGAAACAAGCATGAGGCACACTGGTAGTGACAT
                      ____________________________________________________________
consensus CGACGAAGAGAGAGCATATGATGCGGCAGAAACAAGCATGAGGCACACTGGTAGTGACAT