Previous Contig 001588:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036E02Sequence567001588 (2)gb:ATAC012395_15434836e-36Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete sequence641009897 (2)gb:ATAC012395_15434839e-30Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete sequence
JMSF002N03Sequence353001588 (2)gb:ATAC012395_15434837e-10Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete sequence719009897 (2)gb:ATAC012395_15434831e-60Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036E02+ TGGACTTGAAGCATCAGCTTGGAAATG
                      ____________________________________________________________
consensus TGGACTTGAAGCATCAGCTTGGAAATG
 
. : . : . : . : . : . :
JMFF036E02+ GAAACCCGAGTTATCATCCCCTAGAAGAATAACCTCCTCAGATTCTCTCAATTCTTGCAA
                      ____________________________________________________________
consensus GAAACCCGAGTTATCATCCCCTAGAAGAATAACCTCCTCAGATTCTCTCAATTCTTGCAA
 
. : . : . : . : . : . :
JMFF036E02+ ACTACAACTCTCTCTCTTTCGCCAAAACAAAACACTCCCATACTTATCCTCTAAATACCG
                      ____________________________________________________________
consensus ACTACAACTCTCTCTCTTTCGCCAAAACAAAACACTCCCATACTTATCCTCTAAATACCG
 
. : . : . : . : . : . :
JMFF036E02+ TCCAATTTCAACTAGGGGAATATATACCACGAATAATGAATTACAAATGTATGTTATGAG
                      ____________________________________________________________
consensus TCCAATTTCAACTAGGGGAATATATACCACGAATAATGAATTACAAATGTATGTTATGAG
 
. : . : . : . : . : . :
JMSF002N03+ GGGAAACGCCCGCATCTACAACTGACTGAACAACAAAACTAGCGGCAATCCATAT
JMFF036E02+ AAATGGGGAAACGCCCGCATCTACAACTGACTGAACAACAAAACTAGCGGCAATCCATAT
                      ____________________________________________________________
consensus AAATGGGGAAACGCCCGCATCTACAACTGACTGAACAACAAAACTAGCGGCAATCCATAT
 
. : . : . : . : . : . :
JMSF002N03+ GGATGCAACTAAAAATATGTATACCAAACCTAAAACCCATCTCCAATTTTGTTCTTTCAT
JMFF036E02+ GGATGCAACTAAAAATATGTATACCAAACCTAAAACCCATCTCCAATTTTGTTCTTTCAT
                      ____________________________________________________________
consensus GGATGCAACTAAAAATATGTATACCAAACCTAAAACCCATCTCCAATTTTGTTCTTTCAT
 
. : . : . : . : . : . :
JMSF002N03+ TCCTCTATGGTCAAATTTTTCAACTCAATGCATTTTTAAACAACCAGTTAAGAAGGAAAG
JMFF036E02+ TCCTCTATGGTCAAATTTTTCAACTCAATGCATTTTTAAACAACCAGTTAAGAAGGAAAG
                      ____________________________________________________________
consensus TCCTCTATGGTCAAATTTTTCAACTCAATGCATTTTTAAACAACCAGTTAAGAAGGAAAG
 
. : . : . : . : . : . :
JMSF002N03+ TTTGAATGACAGTAGCAAATATTGTGGAAACAACGTACAAGAAGATTACGAGAAAGAGCG
JMFF036E02+ TTTGAATGACAGTAGCAAATATTGTGGAAACAACGTACAAGAAGATTACGAGAAAGAGCG
                      ____________________________________________________________
consensus TTTGAATGACAGTAGCAAATATTGTGGAAACAACGTACAAGAAGATTACGAGAAAGAGCG
 
. : . : . : . : . : . :
JMSF002N03+ AACCGAAGCGGAGAATCTAATCCACGCGGTAGCGCTGAGGGGAATCTGGAGATTTGGAGG
JMFF036E02+ AACCGAAGCGGAGAATCTAATCCACGCGGTAGCGCTGAGGGGAATCTGGAGATTTGGAGG
                      ____________________________________________________________
consensus AACCGAAGCGGAGAATCTAATCCACGCGGTAGCGCTGAGGGGAATCTGGAGATTTGGAGG
 
. : . : . : . : . : . :
JMSF002N03+ TCCGAAACGGGTTTCTCGCAGAGAAGAAGGAGACGGGGATCCTGGAAGACTGGATCT
JMFF036E02+ TCCGAAACGGGTTTCTCGCAGAGAAGAAGGAGACGGGGATCCTGGAAGACTGGATCTGTC
                      ____________________________________________________________
consensus TCCGAAACGGGTTTCTCGCAGAGAAGAAGGAGACGGGGATCCTGGAAGACTGGATCTGTC