Previous Contig 001587:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009B15Sequence507001587 (22)gb:AY056115_15634512e-41Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.676001587 (22)gb:AY050443_15622192e-53Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMFF036D02Sequence562001587 (22)gb:AY056115_15634512e-42Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.651001587 (22)gb:AY050443_15622192e-57Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMFF043E24Sequence635001587 (22)gb:AY056115_15634513e-54Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.357001587 (22)gb:AY050443_15622192e-18Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMFF049C03Sequence475001587 (22)gb:AY056115_15634515e-36Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.436001587 (22)gb:AY050443_15622198e-19Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMFS013D11Sequence616001587 (22)gb:AY056115_15634516e-53Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.
JMSF023H09Sequence649001587 (22)gb:AY056115_15634511e-44Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.719001587 (22)gb:AY050443_15622198e-59Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMSF028J04Sequence675001587 (22)gb:AY056115_15634517e-52Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.714001587 (22)gb:AY050443_15622195e-58Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMSF030F01Sequence655001587 (22)gb:AY056115_15634516e-52Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.671001587 (22)gb:AY050443_15622192e-53Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMSF040F21Sequence675001587 (22)gb:AY056115_15634514e-55Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.
JMSF043A21Sequence753001587 (22)gb:AY050443_15622194e-69Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A733024011pir|T05986|T059861e-59Tic22 protein homolog F17M5.110 - Arabidopsis thaliana>gb:ATCHRIV79_1547255 Arab
JMSF047A15Sequence696020366gb:AY056115_15634512e-18Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.787001587 (22)gb:AY050443_15622197e-55Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMSF049N24Sequence677001587 (22)gb:AY056115_15634512e-56Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.661001587 (22)gb:AY050443_15622192e-53Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A
JMSF051O23Sequence613001587 (22)gb:AY056115_15634512e-48Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.657001587 (22)gb:AY050443_15622191e-52Arabidopsis thaliana AT4g15470/dl3775w mRNA, complete cds.>gb:AY097356_1576351 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049C03- A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
rJMFF049C03- CCCTGGAGAGTTTTTTTTTTTTTTTTGGCTTACAACTTTTAGTCTTTCCCAGAATCTAAA
                      ____________________________________________________________
consensus CCCTGGAGAGTTTTTTTTTTTTTTTTGGCTTACAACTTTTAGTCTTTCCCAGAATCTAAA
 
. : . : . : . : . : . :
rJMFF049C03- CACAGAAACCAGGTGAGCAAAACAATTTCCATTCCACAATAGAATTTTTAGTGTTTGAGT
rJMSF047A15- CAATAGAATTTTTAGTGTTTGAGT
rJMFF009B15- TTTTAGTGTTTGAGT
rJMSF030F01- TGTTTGAGT
rJMSF028J04- GTGTTTGAGT
rJMSF023H09- GTTTGAGT
                      ____________________________________________________________
consensus CACAGAAACCAGGTGAGCAAAACAATTTCCATTCCACAATAGAATTTTTAGTGTTTGAGT
 
. : . : . : . : . : . :
rJMFF049C03- AGAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
rJMSF047A15- AGAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
rJMSF051O23- GAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
rJMFF009B15- AGAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
rJMSF030F01- AGAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
rJMSF028J04- AGAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
rJMSF049N24- GAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
rJMSF023H09- AGAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
                      ____________________________________________________________
consensus AGAGAGAGTAGGAAACATTTATGATTTATATCTACACAACAGTCTTACTAGTAATGAAAA
 
. : . : . : . : . : . :
rJMFF049C03- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
rJMSF047A15- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
rJMSF051O23- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
rJMFF009B15- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
rJMSF030F01- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
rJMSF028J04- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
rJMSF049N24- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
rJMSF023H09- GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
                      ____________________________________________________________
consensus GTAAAGCATTTATTCAGGGGATGGATTTTGGTACACAGATCAGGGCATTGCAAACTCAGT
 
. : . : . : . : . : . :
rJMFF049C03- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMSF047A15- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMSF051O23- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMFF036D02- TAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMFF043E24- TAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMFF009B15- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMSF030F01- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMSF028J04- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMSF049N24- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
rJMSF023H09- TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
JMSF043A21+ TTGAGGACATCCAGATACA
                      ____________________________________________________________
consensus TGTTTCCCTGTCTAAGCATCCGCAGAATGGTAAGGAACAGGTTGAGGACATCCAGATACA
 
. : . : . : . : . : . :
rJMFF049C03- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMSF047A15- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMSF051O23- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMFF036D02- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMFF043E24- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMFF009B15- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMSF030F01- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMSF028J04- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMSF049N24- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
rJMSF023H09- AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
JMSF049N24+ TGT
JMSF043A21+ AGGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
JMSF040F21+ T
                      ____________________________________________________________
consensus AAGTGACAGATGCCCAGATGTACTGATCATACGTAAACCGCTTGATCAAGTTGTCTGTGT
 
. : . : . : . : . : . :
rJMFF049C03- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMSF047A15- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMSF051O23- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMFF036D02- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMFF043E24- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAAATGGCAGATGATG
rJMFF009B15- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMSF030F01- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMSF028J04- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMSF049N24- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
rJMSF023H09- CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
JMSF049N24+ CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
JMSF043A21+ CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
JMSF040F21+ CATACACGANGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
JMSF030F01+ AATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
JMFS013D11+ CAGATGATG
JMFF043E24+ TGTAGATGGCAGATGATG
JMSF028J04+ AAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
                      ____________________________________________________________
consensus CATACACGATGTATCCACAGAAAATTATAGCACCGATTGCACTGTAGATGGCAGATGATG
 
. : . : . : . : . : . :
rJMFF049C03- TAGAGCCAAGAGGGA
rJMSF047A15- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
rJMSF051O23- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
rJMFF036D02- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
rJMFF043E24- TAAAGCCAAGA
rJMFF009B15- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
rJMSF030F01- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
rJMSF028J04- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
rJMSF049N24- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
rJMSF023H09- TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMSF049N24+ TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMSF043A21+ TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMSF040F21+ TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMSF030F01+ TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMFS013D11+ TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMSF023H09+ GAGCCAAGAGGGAAGAANGCNNGCANGAAGCCAGTCAAGATGAGTATGAAAAGGNTGG
JMFF043E24+ TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMSF028J04+ TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
JMSF051O23+ CATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
                      ____________________________________________________________
consensus TAGAGCCAAGAGGGAAGAACGCCTGCATGAAGCCAGTCAAGATGAGTATGAAAAGGCTGG
 
. : . : . : . : . : . :
rJMSF047A15- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
rJMSF051O23- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
rJMFF036D02- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
rJMFF009B15- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
rJMSF030F01- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
rJMSF028J04- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
rJMSF049N24- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
rJMSF023H09- TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMSF049N24+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMSF043A21+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMSF040F21+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMSF030F01+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMFS013D11+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMSF023H09+ TGAACAGAATTGGTCCCANGAAGNTGAAGTNTTTGCCNTTNTTAGCAGCCCAGAAAGTGT
JMFF043E24+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMSF028J04+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMSF051O23+ TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
JMFF009B15+ AGCCCAGAAAGTGT
JMFF036D02+ TTCTTAGCAGCCCAGAAAGTGT
                      ____________________________________________________________
consensus TGAACAGAATTGGTCCCATGAAGCTGAAGTCTTTGCCCTTCTTAGCAGCCCAGAAAGTGT
 
. : . : . : . : . : . :
rJMSF047A15- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
rJMSF051O23- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
rJMFF036D02- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
rJMFF009B15- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
rJMSF030F01- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
rJMSF028J04- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
rJMSF049N24- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
rJMSF023H09- ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMSF049N24+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMSF043A21+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMSF040F21+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMSF030F01+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMFS013D11+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMSF023H09+ ACCCAGTTAAAGNTGAAANTACAGNTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMFF043E24+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMSF028J04+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMSF051O23+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMFF049C03+ CTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMFF009B15+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
JMFF036D02+ ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
                      ____________________________________________________________
consensus ACCCAGTTAAAGCTGAAACTACAGCTGATGTCAAGATTAAAGCCTCGAGCACAATCATAC
 
. : . : . : . : . : . :
rJMSF047A15- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
rJMSF051O23- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
rJMFF036D02- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
rJMFF009B15- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
rJMSF030F01- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
rJMSF028J04- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
rJMSF049N24- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
rJMSF023H09- CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMSF049N24+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMSF043A21+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMSF040F21+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMSF030F01+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMFS013D11+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMSF023H09+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMFF043E24+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMSF028J04+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMSF051O23+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMFF049C03+ CATCTGTGTTAGCACATGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMFF009B15+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
JMFF036D02+ CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
                      ____________________________________________________________
consensus CATCTGTGTTAGCACAGGTCATGCCAACGGTAAAACTCAGAGAAGCCGTAAAAAGTCCAA
 
. : . : . : . : . : . :
rJMSF047A15- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGA
rJMSF051O23- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
rJMFF036D02- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
rJMFF009B15- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
rJMSF030F01- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
rJMSF028J04- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
rJMSF049N24- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
rJMSF023H09- GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMSF049N24+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMSF043A21+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMSF040F21+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMSF030F01+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMFS013D11+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMSF023H09+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMFF043E24+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMSF028J04+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMSF051O23+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMFF049C03+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMFF009B15+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
JMFF036D02+ GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
                      ____________________________________________________________
consensus GGAAGACGAAGTTCAATGGATGCTTTTGCTGATACACATGCAAAGGCCACAAGAGGATGA
 
. : . : . : . : . : . :
rJMSF051O23- AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATNGCTCCGGAGGAGCTCGTTGAC
rJMFF036D02- AAGGGAGGAAAATTA
rJMFF009B15- AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
rJMSF030F01- AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
rJMSF028J04- AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
rJMSF049N24- AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
rJMSF023H09- AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMSF049N24+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMSF043A21+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMSF040F21+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMSF030F01+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMFS013D11+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMSF023H09+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMFF043E24+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMSF028J04+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMSF051O23+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMFF049C03+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMFF009B15+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
JMFF036D02+ AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
                      ____________________________________________________________
consensus AAGGGAGGAAAATTAGGAAGATAAGGAGGCCGGAATTGCTCCGGAGGAGCTCGTTGACAG
 
. : . : . : . : . : . :
rJMFF009B15- G
rJMSF030F01- GA
rJMSF028J04- GAGCGTANAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGG
rJMSF049N24- GA
rJMSF023H09- GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAG
JMSF049N24+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMSF043A21+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMSF040F21+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMSF030F01+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMFS013D11+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMSF023H09+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMFF043E24+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMSF028J04+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMSF051O23+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMFF049C03+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMFF009B15+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
JMFF036D02+ GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
                      ____________________________________________________________
consensus GAGCGTAGAGGACGGTGATTGCGGAGATGACGGTGGTGAGGAGGATCTGAGCGGCGAGGA
 
. : . : . : . : . : . :
JMSF049N24+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMSF043A21+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMSF040F21+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMSF030F01+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMFS013D11+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMSF023H09+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMFF043E24+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMSF028J04+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMSF051O23+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMFF049C03+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMFF009B15+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
JMFF036D02+ TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
                      ____________________________________________________________
consensus TGCCGTAGACTTTGCGGATGAAACCCCATCGCAGCTGATTCTCTCCGTACCCTAGCCCCG
 
. : . : . : . : . : . :
JMSF049N24+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMSF043A21+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMSF040F21+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMSF030F01+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMFS013D11+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMSF023H09+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMFF043E24+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMSF028J04+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMSF051O23+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMFF049C03+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMFF009B15+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
JMFF036D02+ GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
                      ____________________________________________________________
consensus GATACAAAGTCCCCTCCTCTATATCACCTTTCACTCCTCCATCGTCGCTACTGCTCACTG
 
. : . : . : . : . : . :
JMSF049N24+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMSF043A21+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMSF040F21+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMSF030F01+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMFS013D11+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMSF023H09+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMFF043E24+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMSF028J04+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMSF051O23+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMFF049C03+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMFF009B15+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
JMFF036D02+ CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
                      ____________________________________________________________
consensus CCTCGAATCCGTACATCTTCCGCGCTTTCTCTCTCTAAATCTGATAGAATTCTTCTGCCA
 
. : . : . : . : . : . :
JMSF049N24+ AATTATCTCCGCC
JMSF043A21+ AATTATCTCCGCC
JMSF040F21+ AATTATCTCCGCC
JMSF030F01+ AATTATCTCCGCCGG
JMFS013D11+ AATTATC
JMSF023H09+ AATTATCTCCGCCGGC
JMFF043E24+ AATTATCTCCGCCGGC
JMSF028J04+ AATTATCTCCGCCGGCGAAAGAGTGACAGACGACT
JMSF051O23+ AATTATCTCCGCCGGCGAAAGAGTGACAGACGACT
JMFF049C03+ AATTATCTC
JMFF009B15+ AATTATCTCCGCC
JMFF036D02+ AATTATCTCCGCCGGCGAAAGAGTGACAGACGACTGACAGGTACTTATCCGGGTCGAGAT
                      ____________________________________________________________
consensus AATTATCTCCGCCGGCGAAAGAGTGACAGACGACTGACAGGTACTTATCCGGGTCGAGAT