Previous Contig 001582:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004J06Sequence575001582 (2)gb:AJ630104_18127273e-69Pisum sativum mRNA for galactokinase (galK gene).519009883 (2)gb:AJ630104_18127273e-18Pisum sativum mRNA for galactokinase (galK gene).
JMFF035O20Sequence525001582 (2)gb:AJ630104_18127273e-60Pisum sativum mRNA for galactokinase (galK gene).540009883 (2)gb:AC133339_17414269e-41Oryza sativa chromosome 3 BAC OSJNBa0078D06 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004J06+ ACTGTGCCATCAATGACAACATCAAGTCCAACTGGTAC
                      ____________________________________________________________
consensus ACTGTGCCATCAATGACAACATCAAGTCCAACTGGTAC
 
. : . : . : . : . : . :
JMFF004J06+ ACCAACATCTATTCCCTTCGATTTGGCATACTCATAAAAACCTTTATACCCACAAATAAA
JMFF035O20+ CTTCGATTTGGCATACTCATAAAAACCTTTATACCCACAAATAAA
                      ____________________________________________________________
consensus ACCAACATCTATTCCCTTCGATTTGGCATACTCATAAAAACCTTTATACCCACAAATAAA
 
. : . : . : . : . : . :
JMFF004J06+ ATAATGACCCCATTTGTGATTCTTCAGATCAATTTCCTGGTCGGGAATAGCCGGATAAGT
JMFF035O20+ ATAATGACCCCATTTGTGATTCTTCAGATCAATTTCCTGGTCGGGAATAGCCGGATAAGT
                      ____________________________________________________________
consensus ATAATGACCCCATTTGTGATTCTTCAGATCAATTTCCTGGTCGGGAATAGCCGGATAAGT
 
. : . : . : . : . : . :
JMFF004J06+ GCACATGGAATATTTCTCGCTATTGACATTTGCAATTCTAAGAACCTTCTCGGTCTTATC
JMFF035O20+ GCACATGGAATATTTCTCGCTATTGACATTTGCAATTCTAAGAACCTTCTCGGTCTTATC
                      ____________________________________________________________
consensus GCACATGGAATATTTCTCGCTATTGACATTTGCAATTCTAAGAACCTTCTCGGTCTTATC
 
. : . : . : . : . : . :
JMFF004J06+ CGCACTGTGCTTCCGAATTGCCACGATCGTATCTTGACGAATCGCCATGGGCAACACAGA
JMFF035O20+ CGCACTGTGCTTCCGAATTGCCACGATCGTATCTTGACGAATCGCCATGGGCAACACAGA
                      ____________________________________________________________
consensus CGCACTGTGCTTCCGAATTGCCACGATCGTATCTTGACGAATCGCCATGGGCAACACAGA
 
. : . : . : . : . : . :
JMFF004J06+ GTATCCTTCATAGTCTATATGCTCTCCTATCAAATTCACTCTCCCTGGAGAGCGAGCGTA
JMFF035O20+ GTATCCTTCATAGTCTATATGCTCTCCTATCAAATTCACTCTCCCTGGAGAGCGAGCGTA
                      ____________________________________________________________
consensus GTATCCTTCATAGTCTATATGCTCTCCTATCAAATTCACTCTCCCTGGAGAGCGAGCGTA
 
. : . : . : . : . : . :
JMFF004J06+ AATATCGGGAGGTTGGCCATAGAATTCGACGAACTTTTCCTTGATGCGATTGAACCGGTG
JMFF035O20+ AATATCGGGAGGTTGGCCATAGAATTCGACGAACTTTTCCTTGATGCGATTGAACCGGTG
                      ____________________________________________________________
consensus AATATCGGGAGGTTGGCCATAGAATTCGACGAACTTTTCCTTGATGCGATTGAACCGGTG
 
. : . : . : . : . : . :
JMFF004J06+ CTGCGCTTCCTCGAGCTGCGAGCCGCCGCCGTAGACCGGCTCAAGGGAGGAGTAAGTCGG
JMFF035O20+ CTGCGCTTCCTCGAGCTGCGAGCCGCCGCCGTAGACCGGCTCAAGGGAGGAGTAAGTCGG
                      ____________________________________________________________
consensus CTGCGCTTCCTCGAGCTGCGAGCCGCCGCCGTAGACCGGCTCAAGGGAGGAGTAAGTCGG
 
. : . : . : . : . : . :
JMFF004J06+ GACCGGAAGCTCTTCGTGTCTCGCCATTATCAACCCGATCGATCCTCTTGAGTACTCTCT
JMFF035O20+ GACCGGAAGCTCTTCGTGTCTCGCCATTATCAACCCGATCGATCCTCTTGAGTACTCTCT
                      ____________________________________________________________
consensus GACCGGAAGCTCTTCGTGTCTCGCCATTATCAACCCGATCGATCCTCTTGAGTACTCTCT
 
. : . : . : . : . : . :
JMFF004J06+ GGAAATCTAGAATCACCACTGCAAGGTCTTACGATTTTCTCTCCTTCGGGAAATTAT
JMFF035O20+ GGAAATCTAGAATCACCACTGCAAGGTCTTACGATTTTCTCTCCTTCGGGAAATTATGAT
                      ____________________________________________________________
consensus GGAAATCTAGAATCACCACTGCAAGGTCTTACGATTTTCTCTCCTTCGGGAAATTATGAT