Previous Contig 001580:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035O05Sequence551001580 (4)gb:AY086067_15711259e-07Arabidopsis thaliana clone 20948 mRNA, complete sequence.701001580 (4)gb:AP003526_18304405e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFS095F02Sequence581001580 (4)gb:AY086067_15711254e-08Arabidopsis thaliana clone 20948 mRNA, complete sequence.
JMFS103E09Sequence559001580 (4)gb:AP003526_18304403e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035O05- TTATGATCTTACAATAGTAAAAAATACTGGATGTCTAAAACGATCATAC
                      ____________________________________________________________
consensus TTATGATCTTACAATAGTAAAAAATACTGGATGTCTAAAACGATCATAC
 
. : . : . : . : . : . :
rJMFF035O05- TAGAAAATGAAGATTCAATTGACCAACATCAAGACTATACTTTCTAGTTTCTATACCATG
                      ____________________________________________________________
consensus TAGAAAATGAAGATTCAATTGACCAACATCAAGACTATACTTTCTAGTTTCTATACCATG
 
. : . : . : . : . : . :
rJMFF035O05- AACGCTACAAGAGACATATTTCAACAATGTAAATTTTAGTTTCCACTTTGGTATATAATG
                      ____________________________________________________________
consensus AACGCTACAAGAGACATATTTCAACAATGTAAATTTTAGTTTCCACTTTGGTATATAATG
 
. : . : . : . : . : . :
rJMFF035O05- TCCCAGTTAAGTAACTAGTGCATTTTGCCATCTGCTAGCTTTATTCACACACTAATGGGA
                      ____________________________________________________________
consensus TCCCAGTTAAGTAACTAGTGCATTTTGCCATCTGCTAGCTTTATTCACACACTAATGGGA
 
. : . : . : . : . : . :
rJMFF035O05- CCGTCTCGCGCCTCTTTTGTCCTCTTTCCTTGTTGCAGTTGATGAGAAGCTCTGGTTCAG
                      ____________________________________________________________
consensus CCGTCTCGCGCCTCTTTTGTCCTCTTTCCTTGTTGCAGTTGATGAGAAGCTCTGGTTCAG
 
. : . : . : . : . : . :
rJMFF035O05- GTTCACACTTGGCTGCTCATTCTGAAATGTTCCGTCTCCATAGATGGGTCTCGTGCTACT
                      ____________________________________________________________
consensus GTTCACACTTGGCTGCTCATTCTGAAATGTTCCGTCTCCATAGATGGGTCTCGTGCTACT
 
. : . : . : . : . : . :
rJMFF035O05- AGACTGAGGCACTCTCTCTGTTGAAGGAAGCGCCCAACCTCCCCTGCTTGCCACTCCATT
JMFS103E09+ GGCACTCTCTCTGTTGAAGGAAGCGCCCAACCTCCCCTGCTTGCCACTCCATT
                      ____________________________________________________________
consensus AGACTGAGGCACTCTCTCTGTTGAAGGAAGCGCCCAACCTCCCCTGCTTGCCACTCCATT
 
. : . : . : . : . : . :
rJMFF035O05- CTGAGCATTGCTTCCATCTCCAATAGCACCGTTGGCATTCAACCCCTCGCTCCAACTAGG
JMFS103E09+ CTGAGCATTGCTTCCATCTCCAATAGCACCGTTGGCATTCAACCCCTCGCTCCAACTAGG
                      ____________________________________________________________
consensus CTGAGCATTGCTTCCATCTCCAATAGCACCGTTGGCATTCAACCCCTCGCTCCAACTAGG
 
. : . : . : . : . : . :
rJMFF035O05- AAGATGCATTTTAGCTTTCCCCTTCCAATCTTCCTCAAAACTTGAGAGTTCATCTTCATT
JMFS103E09+ AAGATGCATTTTAGCTTTCCCCTTCCAATCTTCCTCAAAACTTGAGAGTTCATCTTCATT
                      ____________________________________________________________
consensus AAGATGCATTTTAGCTTTCCCCTTCCAATCTTCCTCAAAACTTGAGAGTTCATCTTCATT
 
. : . : . : . : . : . :
rJMFF035O05- AAGGTTGTGCAAAGTTTGCATTGTATCCACTCTACCATCTGGATTCAGTTTCCGCATGAC
JMFS103E09+ AAGGTTGTGCAAAGTTTGCATTGTATCCACTCTACCATCTGGATTCAGTTTCCGCATGAC
                      ____________________________________________________________
consensus AAGGTTGTGCAAAGTTTGCATTGTATCCACTCTACCATCTGGATTCAGTTTCCGCATGAC
 
. : . : . : . : . : . :
rJMFF035O05- AGAATGACCCTTATCATGGATCCCCCTTGAAATCTTATGGCGTGCTTGACCAGTTGCTGA
JMFS103E09+ AGAATGACCCTTATCATGGATCCCCCTTGAAATCTTATGGCGTGCTTGACCAGTTGCTGA
                      ____________________________________________________________
consensus AGAATGACCCTTATCATGGATCCCCCTTGAAATCTTATGGCGTGCTTGACCAGTTGCTGA
 
. : . : . : . : . : . :
rJMFF035O05- ATTAGCTTCTTTACTTTCTTCAAATGCCAATCCATCACTCCCTGTCCTCCTG
JMFS103E09+ ATTAGCTTCTTTACTTTCTTCAAATGCCAATCCATCACTCCCTGTCCTCCTGGTTCTAGA
                      ____________________________________________________________
consensus ATTAGCTTCTTTACTTTCTTCAAATGCCAATCCATCACTCCCTGTCCTCCTGGTTCTAGA
 
. : . : . : . : . : . :
JMFS103E09+ TGAAGTATAATATGCACCATTAGCCCCGCCATAGGTAACAGTTGAACTCTGGAATGTGAA
                      ____________________________________________________________
consensus TGAAGTATAATATGCACCATTAGCCCCGCCATAGGTAACAGTTGAACTCTGGAATGTGAA
 
. : . : . : . : . : . :
JMFS103E09+ ACTTTGTCCCTGGGGCTGTGGTTGAAAATGTTGCATCTGCCTCTGCCCAAACTCATTCCC
JMFS095F02+ TGAAAATGTTGCATCTGCCTCTGCCCAAACTCATTCCC
                      ____________________________________________________________
consensus ACTTTGTCCCTGGGGCTGTGGTTGAAAATGTTGCATCTGCCTCTGCCCAAACTCATTCCC
 
. : . : . : . : . : . :
JMFS103E09+ ATAGTGAATATGCTTCCTCCTCCGCTCTTCAGATTCATCATCTGGGTCCTCAACAAAAGG
JMFS095F02+ ATAGTGAATATGCTTCCTCCTCCGCTCTTCAGATTCATCATCTGGGTCCTCAACAAAAGG
JMFF035O05+ TCAACAAAAGG
                      ____________________________________________________________
consensus ATAGTGAATATGCTTCCTCCTCCGCTCTTCAGATTCATCATCTGGGTCCTCAACAAAAGG
 
. : . : . : . : . : . :
JMFS103E09+ CTCTTCACTCAATCTT-CCATGCTTTC
JMFS095F02+ CTCTTCACTCAATCTT-CCATGCTTTCTTGGATTTCCTTCCATAGTGGTTCTTTCCTTCT
JMFF035O05+ CTCTTCACTCAATCTTCCCATGCTTTCTTGGATTTCCTTCCATAGTGGTTCTTTCCTTCT
                      ____________________________________________________________
consensus CTCTTCACTCAATCTT-CCATGCTTTCTTGGATTTCCTTCCATAGTGGTTCTTTCCTTCT
 
. : . : . : . : . : . :
JMFS095F02+ CTTCGGTTTCATCATCAGAATTTAATTCTTCAATTATAGGCCCCCGAGATGCAGTGCGTT
JMFF035O05+ CTTCGGTTTCATCATCAGAATTTAATTCTTCAATTATAGGCCCCCGAGATGCAGTGCGTT
                      ____________________________________________________________
consensus CTTCGGTTTCATCATCAGAATTTAATTCTTCAATTATAGGCCCCCGAGATGCAGTGCGTT
 
. : . : . : . : . : . :
JMFS095F02+ GCGGGAGCTGCTGCTGTTCAAGGAATCCAGTTGGACGTGAGTCCATAAATTGACTTGCAT
JMFF035O05+ GCGGGAGCTGCTGCTGTTCAAGGAATCCAGTTGGACGTGAGTCCATAAATTGACTTCCAT
                      ____________________________________________________________
consensus GCGGGAGCTGCTGCTGTTCAAGGAATCCAGTTGGACGTGAGTCCATAAATTGACTTGCAT
 
. : . : . : . : . : . :
JMFS095F02+ TAGGCCCAAAAATCCCTGAATTAGGAAATCCAGCTACACGAGAGCCCATAAATTGACTTC
JMFF035O05+ TAGGCCCAAAAATCCCTGAATTAGGAAATCCAGCTACACGAGAGCCCATAAATTGACTTC
                      ____________________________________________________________
consensus TAGGCCCAAAAATCCCTGAATTAGGAAATCCAGCTACACGAGAGCCCATAAATTGACTTC
 
. : . : . : . : . : . :
JMFS095F02+ CATTAGGCCCAAAAATCCCTGGATTAGGAAATCCAGGTAGATTTGGGCCCACATTCGGAC
JMFF035O05+ CATTAGGCCCAAAAATCCCTGGATTAGGAAATCCAGGTAGATTTGGGCCCACATTCGGAC
                      ____________________________________________________________
consensus CATTAGGCCCAAAAATCCCTGGATTAGGAAATCCAGGTAGATTTGGGCCCACATTCGGAC
 
. : . : . : . : . : . :
JMFS095F02+ CAAAAAAGCTCGACTCAAACAAGCCCCCAAATGGTTGTGTGAAGAATGGGTCATCAAAAG
JMFF035O05+ CAAAAAAGCTCGACTCAAACAAGCCCCCAAATGGTTGTGTGAAGAATGGGTCATCAAAAG
                      ____________________________________________________________
consensus CAAAAAAGCTCGACTCAAACAAGCCCCCAAATGGTTGTGTGAAGAATGGGTCATCAAAAG
 
. : . : . : . : . : . :
JMFS095F02+ GATCTCTCCCGCCAAAAAAGCTTGACATTAAACTTCTATGATCTCCAAAACTACCAAAAG
JMFF035O05+ GATCTCTCCCGCCAAAAAAGCTTGACATTAAACTTCTATGATCTCCAAAACTACCAAAAG
                      ____________________________________________________________
consensus GATCTCTCCCGCCAAAAAAGCTTGACATTAAACTTCTATGATCTCCAAAACTACCAAAAG
 
. : . : . : . : . : . :
JMFS095F02+ GGTTACCAAAGCCAAAGAAAGGATCTCTTCCTCCCTCCATTTCACCTTTGATCAATCTGT
JMFF035O05+ GGTTACCAAAGCCAAAGAAAGGATCTCTTCCTCCCTCCATTTCACCTTTGATCAATCTGT
                      ____________________________________________________________
consensus GGTTACCAAAGCCAAAGAAAGGATCTCTTCCTCCCTCCATTTCACCTTTGATCAATCTGT
 
. : . : . : . : . : . :
JMFS095F02+ CCTG
JMFF035O05+ CCTGTCGACGAGAGAGTGAAAAGGGAAGCTCAGCAATGGAGAAAACTTGAAGCCTTAGTT
                      ____________________________________________________________
consensus CCTGTCGACGAGAGAGTGAAAAGGGAAGCTCAGCAATGGAGAAAACTTGAAGCCTTAGTT