Previous Contig 001579:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035O01Sequence613001579 (5)sp|P56821|IF39_TOBAC1e-57Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI703009881 (4)sp|P56821|IF39_TOBAC3e-57Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI
JMSF025I08Sequence484001579 (5)sp|P56821|IF39_TOBAC8e-34Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI
JMSF031A16Sequence645001579 (5)sp|P56821|IF39_TOBAC2e-69Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI783009881 (4)sp|P56821|IF39_TOBAC1e-75Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI
JMSF036I08Sequence632001579 (5)sp|P56821|IF39_TOBAC2e-69Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI777009881 (4)sp|P56821|IF39_TOBAC3e-72Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI
JMSF048A23Sequence618001579 (5)sp|P56821|IF39_TOBAC5e-66Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI699009881 (4)sp|P56821|IF39_TOBAC1e-65Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p110) (eI

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036I08+ CTCCCTTGGAGTATATACTTTT
JMSF031A16+ CTCCCTTGGAGTATATACTTTT
                      ____________________________________________________________
consensus CTCCCTTGGAGTATATACTTTT
 
. : . : . : . : . : . :
JMSF036I08+ GTTTCAGGAGGTGCCCACTCATCTGGAACCTTCATGAATTTCTCAATGTCATCAAACATG
JMSF048A23+ AGGAGGTGCCCACTCATCTGGAACCNTCATGAATTTCTCAATGTCATCAAACATG
JMSF031A16+ GTTTCAGGAGGTGCCCACTCATCTGGAACCTTCATGAATTTCTCAATGTCATCAAACATG
JMFF035O01+ GTCATCAAACATG
                      ____________________________________________________________
consensus GTTTCAGGAGGTGCCCACTCATCTGGAACCTTCATGAATTTCTCAATGTCATCAAACATG
 
. : . : . : . : . : . :
JMSF036I08+ TTGACGGCAAATATATGAGATTTGTCTAATCTGTATCCATGTGTTTTTTCCTTAGCAAGC
JMSF048A23+ TTGACGGCAAATATATGAGATTTGTCTAATCTGTATCCATGTGTTTTTTCCTTAGCAAGC
JMSF031A16+ TTGACGGCAAATATATGAGATTTGTCTAATCTGTATCCATGTGTTTTTTCCTTAGCAAGC
JMFF035O01+ TTGACGGCAAATATATGAGATTNGTCTAATCTGTATCCATGTGTTTTTTCCTTAGCAAGC
                      ____________________________________________________________
consensus TTGACGGCAAATATATGAGATTTGTCTAATCTGTATCCATGTGTTTTTTCCTTAGCAAGC
 
. : . : . : . : . : . :
JMSF036I08+ TCAGCTTCCTGAGGAGTGTTGTACTCAATGAAGCAGTAGCCTAGGGTTTTCTGAGTATCG
JMSF048A23+ TCAGCTTCCTGAGGAGTGTTGTACTCAATGAAGCAGTAGCCTAGGGTTTTCTGAGTATCG
JMSF031A16+ TCAGCTTCCTGAGGAGTGTTGTACTCAATGAAGCAGTAGCCTAGGGTTTTCTGAGTATCG
JMSF025I08+ GAGTATCG
JMFF035O01+ TCAGCTTCCTGAGGAGTGTTGTACTCAATGAAGCAGTAGCCTAGGGTTTTCTGAGTATCG
                      ____________________________________________________________
consensus TCAGCTTCCTGAGGAGTGTTGTACTCAATGAAGCAGTAGCCTAGGGTTTTCTGAGTATCG
 
. : . : . : . : . : . :
JMSF036I08+ GGATCGACCGGCATCCATAGACCATCCTCCTTAATCACCCCAATTTGGCCGTATATTTTA
JMSF048A23+ GGATCGACCGGCATCCATAGACCATCCTCCTTAATCACCCCAATTTGGCCGTATATTTTA
JMSF031A16+ GGATCGACCGGCATCCATAGACCATCCTCCTTAATCACCCCAATTTGGCCGTATATTTTA
JMSF025I08+ GGATCGACCGGCATCCATAGACCATCCTCCTTAATCACCCCAATTTGGCCGTATATTTTA
JMFF035O01+ GGATCGACCGGCATCCATAGACCATCCTCCTTAATCACCCCAATTTGGCCGTATATTTTA
                      ____________________________________________________________
consensus GGATCGACCGGCATCCATAGACCATCCTCCTTAATCACCCCAATTTGGCCGTATATTTTA
 
. : . : . : . : . : . :
JMSF036I08+ CGGACAACACCTTCCAGCTTCTCAAATTTTTCTTTTGGAACGACCGGCAAATTGTCCACC
JMSF048A23+ CGGACAACACCTTCCAGCTTCTCAAATTTTTCTTTTGGAACGACCGGCAAATTGTCCACC
JMSF031A16+ CGGACAACACCTTCCAGCTTCTCAAATTTTTCTTTTGGAACGACCGGCAAATTGTCCACC
JMSF025I08+ CGGACAACACCTTCCAGCTTCTCAAATTTTTCTTTTGGAACGACCGGCAAATTGTCCACC
JMFF035O01+ CGGACAACACCTTCCAGCTTCTCAAATTTTTCTTTTGGAACGACCGGCAAATTGTCCACC
                      ____________________________________________________________
consensus CGGACAACACCTTCCAGCTTCTCAAATTTTTCTTTTGGAACGACCGGCAAATTGTCCACC
 
. : . : . : . : . : . :
JMSF036I08+ ACTATCACGCTCCCAAAACCGGTATCGAACTCCAATGCATCCTCTTCCTCTAAGTCGCCA
JMSF048A23+ ACTATCACGCTCCCAAAACCGGTATCGAACTCCAATGCATCCTCTTCCTCTAAGTCGCCA
JMSF031A16+ ACTATCACGCTCCCAAAACCGGTATCGAACTCCAATGCATCCTCTTCCTCTAAGTCGCCA
JMSF025I08+ ACTATCACGCTCCCAAAACCGGTATCGAACTCCAATGCATCCTNTTCCTGTAAGTCGCCA
JMFF035O01+ ACTATCACGCTCCCAAAACCGGTATCGAACTCCAATGCATCCTCTTCCTCTAAGTCGCCA
                      ____________________________________________________________
consensus ACTATCACGCTCCCAAAACCGGTATCGAACTCCAATGCATCCTCTTCCTCTAAGTCGCCA
 
. : . : . : . : . : . :
JMSF036I08+ TCGTCACTTACGATGCCAAAGTCCTCGCCGGGAGGGAGACGAATGGAGTCCAGATCGATT
JMSF048A23+ TCGTCACTTACGATGCCAAAGTCCTCGCCGGGAGGGAGACGAATGGAGTCCAGATCGATT
JMSF031A16+ TCGTCACTTACGATGCCAAAGTCCTCGCCGGGAGGGAGACGAATGGAGTCCAGATCGATT
JMSF025I08+ TCGTCACNTANGATGCCAAAGTCCTCGCCGGGAGGGAGACGAATGGAGTCCAGATCGATT
JMFF035O01+ TCGTCACTTACGATGCCAAAGTCCTCGCCGGGAGGGAGACGAATGGAGTCCAGATCGATT
                      ____________________________________________________________
consensus TCGTCACTTACGATGCCAAAGTCCTCGCCGGGAGGGAGACGAATGGAGTCCAGATCGATT
 
. : . : . : . : . : . :
JMSF036I08+ TCGGAAAGGTCAATATTGAGCCGAGCAGCCGTGGCTCGAATCTCCTCCATAGACATCGTT
JMSF048A23+ TCGGAAAGGTCAATATTGAGCCGAGCAGCCGTGGCTCGAATCTCCTCCATAGACATCGTT
JMSF031A16+ TCGGAAAGGTCAATATTGAGCCGAGCAGCCGTGGCTCGAATCTCCTCCATAGACATCGTT
JMSF025I08+ TCGGAAAGGTCAATATTGAGCNGAGCAGCCGTGGCTCGAATCTCCTCCATAGACATCGTT
JMFF035O01+ TCGGAAAGGTCAATATTGAGCCGAGCAGCCGTGGCTCGAATCTCCTCCATAGACATCGTT
                      ____________________________________________________________
consensus TCGGAAAGGTCAATATTGAGCCGAGCAGCCGTGGCTCGAATCTCCTCCATAGACATCGTT
 
. : . : . : . : . : . :
JMSF036I08+ TCCGCCATTGTTGGACTCTCTTGCGAACGATTTTGACGCCTTCTTCTTCCTGTCGGTGTT
JMSF048A23+ TCCGCCATTGTTGGACTCTCTTGCGAACGATTTTGACGCCTTCTTCTTCCTGTCGGTGTT
JMSF031A16+ TCCGCCATTGTTGGACTCTCTTGCGAACGATTTTGACGCCTTCTTCTTCCTGTCGGTGTT
JMSF025I08+ TCCGCCATTGTTGGACTCTCTTGCGAACGATTTTGACGCCTTCTTCTTCCNGTCGGTGTT
JMFF035O01+ TCCGCCATTGTTGGACTCTCTTGCGAACGATTTTGACGCCTTCTTCTTCCTGTCGGTGTT
                      ____________________________________________________________
consensus TCCGCCATTGTTGGACTCTCTTGCGAACGATTTTGACGCCTTCTTCTTCCTGTCGGTGTT
 
. : . : . : . : . : . :
JMSF036I08+ GAATGTCTGTATGAGATTGAATTGGTGAAAGAAAGCCAGTTTAAGCTCAGAGACGATGCC
JMSF048A23+ GAATGTCTGTATGAGATTGAATTGGTGAAAGAAAGCCAGTTTAAGCTCAGAGACGATGCC
JMSF031A16+ GAATGTCTGTATGAGATTGAATTGGTGAAAGAAAGCCAGTTTAAGCTCAGAGACGATGCC
JMSF025I08+ GAATGTCTGTATGAGATTGAANTGGTGAAAGAAAGCCAGTTTAAGCTCAGAGACGATGCC
JMFF035O01+ GAATGTCTGTATGAGATTGAATTGGTGAAAGAAAGCCAGTTTAAGCTCAGAGACGATGCC
                      ____________________________________________________________
consensus GAATGTCTGTATGAGATTGAATTGGTGAAAGAAAGCCAGTTTAAGCTCAGAGACGATGCC
 
. : . : . : . : . : . :
JMSF036I08+ GCGAAGTGT
JMSF048A23+ GCGAAGTGTAAGAGCGCAGGAC
JMSF031A16+ GCGAAGTGTAAGAGCGCAGGAC
JMSF025I08+ GCGAAGTGTAAGAGCGCAGGACAAGAGAATACTAGGGTTTTTGTTATGGGATGAT
JMFF035O01+ GCGAAGTGTAAGAGCGCAGGACAAGAGAATACTAGGGTTTTTGTTATGGGATGATATTCT
                      ____________________________________________________________
consensus GCGAAGTGTAAGAGCGCAGGACAAGAGAATACTAGGGTTTTTGTTATGGGATGATATTCT