Previous Contig 001578:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002M09Sequence548001578 (21)gb:D83041_16748112e-97Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.111001578 (21)
JMFF004F04Sequence292001578 (21)gb:D83041_16748111e-33Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.463001578 (21)gb:D83041_16748115e-44Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFF018P23Sequence554001578 (21)gb:D83041_16748112e-98Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.463001578 (21)gb:D83041_16748112e-38Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFF019G04Sequence557001578 (21)gb:D83041_16748112e-98Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.452001578 (21)gb:D83041_16748119e-39Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFF024C03Sequence477001578 (21)gb:D83041_16748114e-83Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.298001578 (21)gb:MFU65643_16860620.003Myristica fragrans acyl-ACP thioesterase (Mf-FatB1) mRNA, complete cds.
JMFF024I17Sequence474001578 (21)gb:D83041_16748113e-82Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.432001578 (21)gb:D83041_16748113e-43Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFF034B08Sequence462001578 (21)gb:D83041_16748116e-79Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFF035N19Sequence560001578 (21)gb:D83041_16748112e-98Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.402001578 (21)gb:D83041_16748113e-27Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFF036I23Sequence545001578 (21)gb:D83041_16748116e-97Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.743001578 (21)gb:D83041_1674811e-140Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFF050G17Sequence608001578 (21)gb:D83041_1674811e-108Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.613001578 (21)gb:D83041_1674811e-104Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.
JMFN014E14Sequence627001578 (21)gb:AB023788_15156382e-96Ipomoea batatas f3h I mRNA for fravanone 3-hydroxyrase, complete cds.
JMFN033A15Sequence483001578 (21)gb:D83041_16748118e-56Ipomoea nil mRNA for 2-oxogulutarate 3-dioxygenase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024C03- AATTCTGGACTAATTTCGATTCACACCGNT
                      ____________________________________________________________
consensus AATTCTGGACTAATTTCGATTCACACCGNT
 
. : . : . : . : . : . :
rJMFF024C03- ATTGACCCAATTAATGACAAATGCGGAGTGTACAATTAGTCGCGCCAACCACAGGGGTTT
                      ____________________________________________________________
consensus ATTGACCCAATTAATGACAAATGCGGAGTGTACAATTAGTCGCGCCAACCACAGGGGTTT
 
. : . : . : . : . : . :
rJMFF002M09- ATGAAGTGTGATTTTGGGAGG
rJMFF024C03- ATCAAAAGACTCATTAACCAAACCCTCCACATAAAATCAATGAAGTGTGATTTTGGGAGG
rJMFF019G04- ATGAAGTGTGATTTTGGGAGG
rJMFF035N19- ATGAAGTGTGATTTTGGGAGG
rJMFF004F04- ATGAAGTGTGATTTTGGGAGG
rJMFF018P23- ATGAAGTGTGATTTTGGGAGG
JMFN033A15+ TTTTGGGAGG
                      ____________________________________________________________
consensus ATCAAAAGACTCATTAACCAAACCCTCCACATAAAATCAATGAAGTGTGATTTTGGGAGG
 
. : . : . : . : . : . :
rJMFF002M09- AAATCTTATTTCTCAAAGAACACAGAGTTTTTGCATATATATATATATATATATATATA
rJMFF024C03- AAATCTTATTTCTCAAAGAACACAGAGTTTTTGCATATATATATATATATATATATATAC
rJMFF019G04- AAATCTTATTTCTCAAAGAACACAGAGTTTTTGCATATATATATATATATATATATATAC
rJMFF035N19- AAATCTTATTTCTCAAAGAACACAGAGTTTTTGCATATATATATATATATATATATATAN
rJMFF004F04- AAATCTTATTTCTCAAAGAACACAGAGTTTTTGCATATATATATATATATATATATATAN
rJMFF018P23- AAATCTTATTTCTCAAAGAACACAGAGTTTTTGCATATATATATATATATATATATATAN
rJMFF024I17- AAGAACACAGAGTTTTTGCATATATATATATATATATATATATAN
JMFN033A15+ AAATCTTATTTCTCAAAGAACACAGAGTTTTGGCATATATATATATATATATATATATAG
                      ____________________________________________________________
consensus AAATCTTATTTCTCAAAGAACACAGAGTTTTTGCATATATATATATATATATATATATAC
 
. : . : . : . : . : . :
rJMFF024C03- TGAGTGTCCTTANTGNATATATAATTAGNTAACANATGGAAATAGCANCCGAATTTATAT
rJMFF019G04- TGAGTGTCCTTANTGNATATATAATTANTTAACAGATGGAAATAGCANCCGAATTTATAT
rJMFF035N19- TGAGTGTCCTTANTGNATATATAATTANTTAACAGATGGAAATAGCANCCGAATTTATAT
rJMFF004F04- TGAGTGTCCTTANTGNATATATAATTANTTAACAGATGGAAATAGCANCCGAATTTATAT
rJMFF018P23- TGAGTGTCCTTANTGNATATATAATTANTTAACAGATGGAAATAGCANCCGAATTTATAT
rJMFF024I17- TGAGTGTCCTTANTGNATATATAATTANTTAACAGATGGAAATAGCANCCGAATTTATAT
JMFN033A15+ TGAGTGTCCTTACTGCATATATAATTAGTTAACAGATGGAAATAGCAGCCGAATTTATAT
rJMFF050G17- CCGAATTTATAT
                      ____________________________________________________________
consensus TGAGTGTCCTTACTGCATATATAATTAGTTAACAGATGGAAATAGCAGCCGAATTTATAT
 
. : . : . : . : . : . :
rJMFF024C03- GAATTATTANGCAAGAATTTGATC
rJMFF019G04- GAATTATTAAGCAAGAATTTGATCNATAGGTTTANTTTCCAAGNTGGTATCTCCAGCANC
rJMFF035N19- GAATTATTANGCAAGAATTTGATCNATAGGTTTANTTTCCAAGNTGGTATCTCCNNCANC
rJMFF004F04- GAATTATTAAGCAAGAATTTGATCNATAGGTTTANTTTCCAAGTTGGTATCTCCAGCANC
rJMFF018P23- GAATTATTAAGCAAGAATTTGATCNATAGGTTTANTTTCCAAGNTGGTATCTCCANCANC
rJMFF024I17- GAATTATTAAGCAAGAATTTGATCNATAGGTTTANTTTCCAAGTTGGTATCTCCANCANC
JMFN033A15+ GAATTATTAAGCAAGAATTTGATCAATAGGTTTAGTTTCCAAGTTGGTATCTCCAGCAGC
rJMFF050G17- GAATTATTAAGCAAGAATTTGATCAATAGGTTTAGTTTCCAAGTTGGTATCTCCAGCAGC
rJMFF036I23- ATTATTAAGCAAGAATTTGATCAATAGGTTTAGTTTCCAAGTTGGTATCTCCAGCAGC
                      ____________________________________________________________
consensus GAATTATTAAGCAAGAATTTGATCAATAGGTTTAGTTTCCAAGTTGGTATCTCCAGCAGC
 
. : . : . : . : . : . :
rJMFF019G04- CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCANATCCTT
rJMFF035N19- CGCCTNTATCATTTGNTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCAGATCCNT
rJMFF004F04- CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCAGATCCTT
rJMFF018P23- CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCNTGGNAAGCTCCANATCCNT
rJMFF024I17- CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCANATCCTT
JMFN033A15+ CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCAGATCCTT
rJMFF050G17- CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCAGATCCTT
rJMFF036I23- CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCAGATCCTT
                      ____________________________________________________________
consensus CGCCTTTATCATTTGCTGCTCCTTTGCAAACTTCTTGATCCTGGCAAGCTCCAGATCCTT
 
. : . : . : . : . : . :
rJMFF019G04- GCTCATCTTCCTCNTGTANATCTCTGCAAACGNGATGGGCTCTTCCAGANTGGACTTCTC
rJMFF035N19- GCTCATCTTCCTCNTGTANATCTCTGCAAACGNGATGGGCTCTTCCANANTGGGCTTCTC
rJMFF004F04- GCTCATCTTCCTCCTGTANATCTCTGCAAACGNGATGGGCTCTTCCANANTGGGCTTCTC
rJMFF018P23- GCTCATCTTCCTCNTGTANATCTCTGCAAACGNGATGGGCTCTTCCAGANTGGGCTTCTC
rJMFF024I17- GCTCATCTTCCTCCTGTANATCTCTGCAAACGNGATGGGCTCTTCCAGANTGGGCTTCTC
JMFN033A15+ GCTCATCTTCCTCCTGTACATCTCTGCAAACGTGATGGGCTCTTCCAGAATGGGCTTCTC
rJMFF050G17- GCTCATCTTCCTCCTGTACATCTCTGCAAACGTGATGGGCTCTTCCAGAATGGGCTTCTC
rJMFF036I23- GCTCATCTTCCTCCTGTACATCTCTGCAAACGTGATGGGCTCTTCCAGAATGGGCTTCTC
                      ____________________________________________________________
consensus GCTCATCTTCCTCCTGTACATCTCTGCAAACGTGATGGGCTCTTCCAGAATGGGCTTCTC
 
. : . : . : . : . : . :
rJMFF019G04- CCCTTCCCTCACCTTCAACGGGTACACCTTCNCCTCCGGCGCCNGATTCTGAAACGTCNC
rJMFF035N19- CCCTTCCCTCACCTTCAANGGNTACACCTTCNCCTCCGGCGCCNGATTCNGAAACGTCTC
rJMFF004F04- CCCTTCCCTCACCTTCAACGGGTACACCTTCNCCTCCGGCGCCNGATTCTGAAACGTCNC
rJMFF018P23- CCCTTCCCTCACCTTCAACGGNNACACCTTCNCCTCCGGCGCCNGATTCTGAAACNTCTC
rJMFF024I17- CCCTTCCCTCACCTTCAACGGNTACACCTTCNCCTCCGGCGCCGGATTCTGAAACGTCNC
JMFN033A15+ CCCTTCCCTCACCTTCAACGGGTACACCTTCGCCTCCGGCGCCGGATTCTGAAACGTCGC
rJMFF050G17- CCCTTCCCTCACCTTCAACGGGTACACCTTCGCCTCCGGCGCCGGATTCTGAAACGTCGC
rJMFF036I23- CCCTTCCCTCACCTTCAACGGGTACACCTTCGCCTCCGGCGCCGGATTCTGAAACGTCGC
                      ____________________________________________________________
consensus CCCTTCCCTCACCTTCAACGGGTACACCTTCGCCTCCGGCGCCGGATTCTGAAACGTCGC
 
. : . : . : . : . : . :
rJMFF019G04- TATANACATCCGGNTGTGTTCTGAGNTCNCCACCGCTTGATGGNCCGCATTCTTGAACCT
rJMFF035N19- TATANACNTCCGGNTGTGTTC
rJMFF004F04- TATANACATCCGGNTGTGTTCTGAGNTCACCACCGCTTGATGGTCCGCATTCTTGAACCT
rJMFF018P23- TATANACATCCGGNTGTGTTCTGAGNTCACCACCGCTTGATGGNCCGCATTCTTGAACCT
rJMFF024I17- TATANACATCCGGNTGTGTTCTGAGTTCACCACCGCTTGATGGNCCNCATTCTTGAACCT
JMFN033A15+ TATAGACATCCGGCTGTGTTCTGAGTTCACCACCGCTTGATGGTCCGCATTCTTGAACCT
rJMFF050G17- TATAGACATCCGGCTGTGTTCTGAGTTCACCACCGCTTGATGGTCCGCATTCTTGAACCT
rJMFF036I23- TATAGACATCCGGCTGTGTTCTGAGTTCACCACCGCTTGATGGTCCGCATTCTTGAACCT
                      ____________________________________________________________
consensus TATAGACATCCGGCTGTGTTCTGAGTTCACCACCGCTTGATGGTCCGCATTCTTGAACCT
 
. : . : . : . : . : . :
rJMFF019G04- CCCATTACTCA
rJMFF004F04- CCCATTACTCANAAAGTGG
rJMFF018P23- CCCATTACTCANAAAGTGGCCG
rJMFF024I17- CCCATTACTCANAAAGTGG
JMFN033A15+ CCCATTACTCAGAAAGTGGCCGTGGTCGCCGAGGT
rJMFF050G17- CCCATTACTCAGAAAGTGGCCGTGGTCGCCGAGGTTAACAACAAAAGCGCCATCGACTGG
rJMFF036I23- CCCATTACTCAGAAAGTGGCCGTGGTCGCCGAGGTTAACAACAAAAGCGCCATCGACTGG
                      ____________________________________________________________
consensus CCCATTACTCAGAAAGTGGCCGTGGTCGCCGAGGTTAACAACAAAAGCGCCATCGACTGG
 
. : . : . : . : . : . :
rJMFF050G17- CTGAACAGTGATCCATGTTTTGCCACCATCTTTGGTGGCTTGGAGACCGCCAACTTGATC
rJMFF036I23- CTGAACAGTGATCCATGTTTTGCCACCATCTTTGGTGGCTTGGAGACCGCCAACTTGATC
                      ____________________________________________________________
consensus CTGAACAGTGATCCATGTTTTGCCACCATCTTTGGTGGCTTGGAGACCGCCAACTTGATC
 
. : . : . : . : . : . :
rJMFF050G17- CTGCAACAGAAGGGTGATGGTTCCAGGGTCTGTGTGGCGTTTTAGGCCGAGGGTTAGGTC
rJMFF036I23- CTGCAACAGAAGGGTGATGGTTCCAGGGTCTGTGTGGCGTTTTAGGCCGAGGGTTAGGTC
                      ____________________________________________________________
consensus CTGCAACAGAAGGGTGATGGTTCCAGGGTCTGTGTGGCGTTTTAGGCCGAGGGTTAGGTC
 
. : . : . : . : . : . :
rJMFF050G17- AGGCTCGGGGCATTTTGGGTAGAAATTGACCACCAGTTTTTGGTCCAATTCCACACAGGC
rJMFF036I23- AGGCTCGGGGCATTTTGGGTAGAAATTGACCACCAGTTTTTGGTCCAATTCCACACAGGC
JMFN014E14+ GTCCATTTCCACACAGGC
JMFF050G17+ GTCCAATTCCACACAGGC
                      ____________________________________________________________
consensus AGGCTCGGGGCATTTTGGGTAGAAATTGACCACCAGTTTTTGGTCCAATTCCACACAGGC
 
. : . : . : . : . : . :
rJMFF050G17- TTTGCTCAATGCTTCCTTCTCCAATCCCAT
rJMFF036I23- TTTGCTCAATGCTTCCTTCTCCAATCCCATTGCCTCTGATAAAACCTCCAGCAGTTTGCA
JMFN014E14+ TNTGCTCAATGCTTCCTTCTCCAATCCCATTGCCTCTGATAAAACCTCCAGCAGTTTGCA
JMFF050G17+ TTTGCTCAATGCTTCCTTCTCCAATCCCATTGCCTCTGATAAAACCTCCAGCAGTTTGCA
JMFF002M09+ AACCTCCAGCAGTTTGCA
JMFF019G04+ TGATAAAACCTCCAGCAGTTTGCA
JMFF018P23+ TGATAAAACCTCCAGCAGTTTGCA
JMFF036I23+ CTCCAGCAGTTTGCA
JMFF035N19+ TCTGATAAAACCTCCAGCAGTTTGCA
                      ____________________________________________________________
consensus TTTGCTCAATGCTTCCTTCTCCAATCCCATTGCCTCTGATAAAACCTCCAGCAGTTTGCA
 
. : . : . : . : . : . :
rJMFF036I23- TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTAACTGCCCTCCACCCTTCTGGCTT
JMFN014E14+ TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTTACTGCCCTCAACCCTTCTGGCTT
JMFF050G17+ TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTAACTGCCCTCCACCCTTCTGGCTT
JMFF024C03+ CTGGCTT
JMFF024I17+ GCTT
JMFF002M09+ TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTTACTGCCCTCCACCCTTCTGGCTT
JMFF019G04+ TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTTACTGCCCTCCACCCTTCTGGCTT
JMFF018P23+ TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTTACTGCCCTCCACCCTTCTGGCTT
JMFF036I23+ TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTAACTGCCCTCCACCCTTCTGGCTT
JMFF004F04+ GCTT
JMFF035N19+ TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTTACTGCCCTCCACCCTTCTGGCTT
                      ____________________________________________________________
consensus TGCCAAGTCCATCAACTTTTCACTGTACTTTTCCGTTACTGCCCTCCACCCTTCTGGCTT
 
. : . : . : . : . : . :
rJMFF036I23- GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFN014E14+ GTCCGGCCACCTTGAATAGTCCCTTGCCCTCACCGGGTATGAGCTATACGTCATGAATTC
JMFF050G17+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF024C03+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF024I17+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF034B08+ ACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF002M09+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF019G04+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF018P23+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF036I23+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF004F04+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
JMFF035N19+ GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
                      ____________________________________________________________
consensus GTCGGGCCACCTTGAATAATCCCTTGCTCTCACTGGGTATGAGAAATACGTCACGATTTC
 
. : . : . : . : . : . :
rJMFF036I23- TCGCCAATCCTTCACTGCTTCACCC
JMFN014E14+ TCGCCAATTTTTCACTGCTTCACCCTGGAGATGGCTGGAAACTCGGAAGCCGTCTTTCTG
JMFF050G17+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF024C03+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF024I17+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF034B08+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF002M09+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF019G04+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF018P23+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF036I23+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF004F04+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
JMFF035N19+ TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
                      ____________________________________________________________
consensus TCGCCAATCCTTCACTGCTTCACCCTGGAGATGGCTGGAAACGATGAAGCCGCCTTTCTT
 
. : . : . : . : . : . :
JMFN014E14+ GCCGCCGGAAACGTCAAACCGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCCTTAGA
JMFF050G17+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF024C03+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF024I17+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF034B08+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF002M09+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF019G04+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF018P23+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF036I23+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF004F04+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
JMFF035N19+ GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
                      ____________________________________________________________
consensus GCCGCCGGACATGTCAAACAGGAGCTTTTCCTCCGGCGGCAAGGAGAAGAAGTCTTTAGA
 
. : . : . : . : . : . :
JMFN014E14+ AAGGCGGGACATTTCTCCGATCATCCCGGCGTCAACCCCATGATCAACCACCTGAAAGAT
JMFF050G17+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF024C03+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF024I17+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF034B08+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF002M09+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF019G04+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF018P23+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF036I23+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
JMFF004F04+ AAGGCGGGTCATTTCTCCG
JMFF035N19+ AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
                      ____________________________________________________________
consensus AAGGCGGGTCATTTCTCCGATCAGCCCGGCATCAACCCCATGATCAACCACCTGAAAGAT
 
. : . : . : . : . : . :
JMFN014E14+ CCCCCAATCTTCACACGCCTTCACAATCTCGTCGCGAATTTGTACTCGCCGGCCATGGAC
JMFF050G17+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF024C03+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF024I17+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF034B08+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF002M09+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF019G04+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF018P23+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF036I23+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
JMFF035N19+ CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
                      ____________________________________________________________
consensus CCCCCAATCTTCACACGCCTTCACAATCTCCTTGCGGATTTGGACTCGCCGGCCAAGGAC
 
. : . : . : . : . : . :
JMFN014E14+ GTCGTCGTCAATGCCCTTTAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF050G17+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF024C03+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF024I17+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF034B08+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF002M09+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF019G04+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF018P23+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF036I23+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
JMFF035N19+ ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
                      ____________________________________________________________
consensus ---GTCGTCAATGCCCTTCAAAGATATCACCGGAATCTCGTCACTGAACTCGTTATAACC
 
. : . : . : . : . : . :
JMFN014E14+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATTGCAGAAGAGCCGTCTCCCC
JMFF050G17+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF024C03+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF024I17+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF034B08+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF002M09+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF019G04+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF018P23+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF036I23+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
JMFF035N19+ CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
                      ____________________________________________________________
consensus CACTTTGGGACGCTCGTCTTCGTCCCTCACGAAGCTCGATCGC---AGAGCCGTCTCCCC
 
. : . : . : . : . : . :
JMFN014E14+ TGCTAGCGCCATTAAGGTTGACAACGTCGTC
JMFF050G17+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTT
JMFF024C03+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTT
JMFF024I17+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTT
JMFF034B08+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTT
JMFF002M09+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTT
JMFF019G04+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTT
JMFF018P23+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTT
JMFF036I23+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTT
JMFF035N19+ TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTTGGCT
                      ____________________________________________________________
consensus TGCTAGCGCCGTTAAGGTTGACAACGTCGTCATCTTGCTTTAATTTTGTTTTTCTTGGCT