Previous Contig 001576:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035K18Sequence596001576 (4)gb:AF165422_17737352e-17Mesembryanthemum crystallinum salt-induced AAA-Type ATPase (SKD1) mRNA, complete783009871 (3)gb:AF419850_17985801e-68Musa acuminata suppressor of K+ transport growth defect-like protein (SDK1) mRNA
JMFF046P21Sequence590001576 (4)gb:AF165422_17737351e-11Mesembryanthemum crystallinum salt-induced AAA-Type ATPase (SKD1) mRNA, complete
JMSF014P10Sequence342001576 (4)781009871 (3)gb:AF419850_17985806e-92Musa acuminata suppressor of K+ transport growth defect-like protein (SDK1) mRNA
JMSF029J08Sequence629001576 (4)gb:AF165422_17737351e-37Mesembryanthemum crystallinum salt-induced AAA-Type ATPase (SKD1) mRNA, complete750009871 (3)gb:AF419850_17985802e-91Musa acuminata suppressor of K+ transport growth defect-like protein (SDK1) mRNA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029J08+ TTGCTGCAGGTCCATTACCCCCTCCCTCATCAAGAACTGCCCGAAT
                      ____________________________________________________________
consensus TTGCTGCAGGTCCATTACCCCCTCCCTCATCAAGAACTGCCCGAAT
 
. : . : . : . : . : . :
JMSF029J08+ CTCCTCAGCCCTCCTCAAATACTCAGTGAACTTCTGGGTAATTGCCTCCTTAACCTTTGG
                      ____________________________________________________________
consensus CTCCTCAGCCCTCCTCAAATACTCAGTGAACTTCTGGGTAATTGCCTCCTTAACCTTTGG
 
. : . : . : . : . : . :
JMSF029J08+ ATTCTTCTCATACTTTAAATGAGTCTTAAAATACTCCAATGCATTCATATACAAAGAAAA
JMFF046P21+ TTAAATGAGTC-TAAAATACTCCAATGCATTCATATACAAGNAAAA
JMFF035K18+ TTAAATGAGTCTTAAAATACTCCAATGCATTCATATACAAAGAAAA
                      ____________________________________________________________
consensus ATTCTTCTCATACTTTAAATGAGTCTTAAAATACTCCAATGCATTCATATACAAAGAAAA
 
. : . : . : . : . : . :
JMSF029J08+ GGCCTTTGCATAATTCCCAGCATTATCTTCCTCAACCGCTTGCTTCACATATGCTACTGC
JMFF046P21+ GGCCTTTGCATAATTCCCAGCATATTCTTCCTCAACCGCTTGCTTCACATATGCTACTGC
JMFF035K18+ GGCCTTTGCATAATTCCCAGCATTATCTTCCTCAACCGCTTGCTTCACATATGCTACTGC
                      ____________________________________________________________
consensus GGCCTTTGCATAATTCCCAGCATTATCTTCCTCAACCGCTTGCTTCACATATGCTACTGC
 
. : . : . : . : . : . :
JMSF029J08+ CTGCTCCTTAAAATTGCTATACATCCTTTCTTCACAAAAACCTCATAAAATTCCAAATAT
JMFF046P21+ CTGCTCCTTAAAATTGCTATACATCCTTTCTTCACAAAAACCTCATAAAATTCCAAATAT
JMFF035K18+ CTGCTCCTTAAAATTGCTATACATCCTTTCTTCACAAAAACCTCATAAAATTCCAAATAT
                      ____________________________________________________________
consensus CTGCTCCTTAAAATTGCTATACATCCTTTCTTCACAAAAACCTCATAAAATTCCAAATAT
 
. : . : . : . : . : . :
JMSF029J08+ ATCAGTCAAGCCCCTAAAATCACCTTCACAGCTTAAGTCAATTACTCCTCAATTTGGCCA
JMFF046P21+ ATCAGTCAAGCCCCTAAAATCACCTTCACAGCTTAAGTCAATTACTCCTCAATTTGGCCA
JMSF014P10+ TCAGTCAAGCCCCTAAAATCACCTTCACAGCTTAAGTCAATTACTCCTCAATTTGGCCA
JMFF035K18+ ATCAGTCAAGCCCCTAAAATCACCTTCACAGCTTAAGTCAATTACTCCTCAATTTGGCCA
                      ____________________________________________________________
consensus ATCAGTCAAGCCCCTAAAATCACCTTCACAGCTTAAGTCAATTACTCCTCAATTTGGCCA
 
. : . : . : . : . : . :
JMSF029J08+ AAAAACTAGACAACCCAATTCTGAAATCCTTCCAACACCCAGATAAAAAAACAATTCTTT
JMFF046P21+ AAAAACTAGACAACCCAATTCTGAAATCCTTCCAACACCCAGATAAAAAAACAATTCTTT
JMSF014P10+ AAAAACTAGACAACCCAATTCTGAAATCCTTCCAACACCCAGATAAAAAAACAATTCTTT
JMFF035K18+ AAAAACTAGACAACCCAATTCTGAAATCCTTCCAACACCCAGATAAAAAAACAATTCTTT
                      ____________________________________________________________
consensus AAAAACTAGACAACCCAATTCTGAAATCCTTCCAACACCCAGATAAAAAAACAATTCTTT
 
. : . : . : . : . : . :
JMSF029J08+ TGAAAGAAGTCCCTTCAAAACTATGGAAAACTACTCACAGCTGACAGCCCAATCCTTGAT
JMFF046P21+ TGAAAGAAGTCCCTTCAAAACTATGGAAAACTACTCACAGCTGACAGCCCAATCCTTGAT
JMSF014P10+ TGAAAGAAGTCCCTTCAAAACTATGGAAAACTACTCACAGCTGACAGCCCAATCCTTGAT
JMFF035K18+ TGAAAGAAGTCCCTTCAAAACTATGGAAAACTACTCACAGCTGACAGCCCAATCCTTGAT
                      ____________________________________________________________
consensus TGAAAGAAGTCCCTTCAAAACTATGGAAAACTACTCACAGCTGACAGCCCAATCCTTGAT
 
. : . : . : . : . : . :
JMSF029J08+ TCTTCATATTATGAATTTATGATACTCTCTGTCTCTCTTCACTGTAAACCCCTAAGAAAA
JMFF046P21+ TCTTCATATTATGAATTTATGATACTCTCTGTCTCTCTTCACTGTAAACCCCTAAGAAAA
JMSF014P10+ TCTTCATATTATGAATTTATGATACTCTCTGTCTCTCTTCACTGTAAACCCCTAAGAAAA
JMFF035K18+ TCTTCATATTATGAATTTATGATACTCTCTGTCTCTCTTCACTGTAAACCCCTAAGAAAA
                      ____________________________________________________________
consensus TCTTCATATTATGAATTTATGATACTCTCTGTCTCTCTTCACTGTAAACCCCTAAGAAAA
 
. : . : . : . : . : . :
JMSF029J08+ TGGGAACCCGGACTTGGATCAAGGGGAAGAAGCAAGCCAATGATAGTTGTATATTTGAGT
JMFF046P21+ TGGGAACCCGGACTTGGATCAAGGGGAAGAAGCAAGCCAATGATAGTTGTATATTTGAGT
JMSF014P10+ TGGGAACCCGGACTTGGATCAAGGGGAAGAAGCAAGCCAATGATAGTTGTATATTTGAGT
JMFF035K18+ TGGGAACCCGGACTTGGATCAAGGGGAAGAAGCAAGCCAATGATAGTTGTATATTTGAGT
                      ____________________________________________________________
consensus TGGGAACCCGGACTTGGATCAAGGGGAAGAAGCAAGCCAATGATAGTTGTATATTTGAGT
 
. : . : . : . : . : . :
JMSF029J08+ TGTGGCGTGCGG---GGGAAATTTGAGAGAGAGAGAAAGTC
JMFF046P21+ TGTGGCGTGCGGGATGGGAAATTTGAGAGAGAGAGAAAGTCTCCTATTCTTGATCGGTCT
JMSF014P10+ TGTGGCGTGCGG---GGGAAATTTGAGAGAGAGAGAAAGTCTCCT
JMFF035K18+ TGTGGCGTGCGGGATGGGAAATTTGAGAGAGAGAGAAAGTCTCCTATTCTTGATCGGTCT
                      ____________________________________________________________
consensus TGTGGCGTGCGGGATGGGAAATTTGAGAGAGAGAGAAAGTCTCCTATTCTTGATCGGTCT
 
. : . : . : . : . : . :
JMFF046P21+ CCGCTGTCCGCTGATTGATAGATACTTTCCTAATCGCGAAGCAGCACAGGCATTTCCATC
JMFF035K18+ CCGCTGTCCGCTGATTGATAGATACTTTCCTAATCGCGAAGCAGCACAGGCATTTCCATC
                      ____________________________________________________________
consensus CCGCTGTCCGCTGATTGATAGATACTTTCCTAATCGCGAAGCAGCACAGGCATTTCCATC