Previous Contig 001575:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O07Sequence534001575 (62)gb:AF149251_17725022e-74Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.744001575 (62)gb:AF149251_17725022e-88Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF003K11Sequence592001575 (62)gb:AF149251_17725022e-85Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.695001575 (62)gb:AF149251_17725023e-88Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF007F09Sequence610001575 (62)gb:AF101427_17681632e-71Cichorium intybus peroxidase mRNA, partial cds.705001575 (62)gb:AF149251_17725024e-99Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF007O18Sequence400001575 (62)gb:AF149251_17725021e-54Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.764006411 (4)gb:AY043232_15609821e-85Vitis vinifera pectin methylesterase mRNA, complete cds.
JMFF016E14Sequence544001575 (62)gb:AF149251_17725022e-77Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF017D08Sequence503001575 (62)gb:AF149251_17725027e-24Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF019N10Sequence544001575 (62)gb:AF149251_17725022e-77Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.689001575 (62)gb:AF149251_17725023e-88Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF020I09Sequence695001575 (62)gb:AF149251_17725029e-90Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF021J18Sequence536001575 (62)gb:AF149251_17725025e-76Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.624001575 (62)gb:AF149251_17725021e-77Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF026I23Sequence546001575 (62)gb:AF149251_17725022e-77Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.693001575 (62)gb:AF149251_17725029e-90Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF026M02Sequence741001575 (62)gb:AF149251_17725021e-98Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF030P16Sequence473001575 (62)gb:AF149251_17725021e-65Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.567001575 (62)gb:AF149251_17725022e-67Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF033J22Sequence458001575 (62)gb:AF149251_17725023e-57Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.688001575 (62)gb:AF149251_17725023e-88Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF033N14Sequence516001575 (62)gb:AF149251_17725021e-72Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.697001575 (62)gb:AF149251_17725023e-90Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF034C23Sequence510001575 (62)gb:AF149251_17725024e-71Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.707001575 (62)gb:AF149251_17725022e-88Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF034E16Sequence716001575 (62)gb:AF149251_17725023e-63Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF035K06Sequence529001575 (62)gb:AF149251_17725022e-62Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.696001575 (62)gb:AF149251_17725029e-90Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF036G03Sequence595001575 (62)gb:AF149251_17725023e-86Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.696001575 (62)gb:AF149251_17725029e-90Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF036J20Sequence547001575 (62)gb:AF149251_17725024e-78Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF037J09Sequence562001575 (62)gb:AF149251_17725022e-76Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.689001575 (62)gb:AF149251_17725023e-88Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF039H21Sequence508001575 (62)gb:AF149251_17725026e-66Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.692001575 (62)gb:AF149251_17725026e-96Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF041H14Sequence618001575 (62)gb:AF149251_17725023e-91Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.575001575 (62)gb:AF149251_17725021e-69Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF043A06Sequence635001575 (62)gb:AF149251_17725023e-94Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.334001575 (62)pir|T10790|T107904e-12peroxidase (EC 1.11.1.7) - upland cotton>gb:COTPROXDS_1648410 Gossypium hirsutum
JMFF043B20Sequence636001575 (62)gb:AF149251_17725028e-89Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.349001575 (62)pir|T10790|T107907e-15peroxidase (EC 1.11.1.7) - upland cotton>gb:COTPROXDS_1648410 Gossypium hirsutum
JMFF043H15Sequence641001575 (62)gb:AF149251_17725023e-84Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF044F04Sequence639001575 (62)gb:AF149251_17725023e-95Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.562001575 (62)gb:AF149251_17725022e-59Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF044F10Sequence641001575 (62)gb:AF149251_17725029e-96Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.622001575 (62)gb:AF149251_17725021e-63Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFF044G09Sequence640001575 (62)gb:AF149251_17725021e-90Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.557001575 (62)gb:AF149251_17725022e-58Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFN007G21Sequence128001575 (62)gb:AB049589_15208930.005Avicennia marina PER mRNA for secretory peroxidase, complete cds.
JMFN014N11Sequence614001575 (62)gb:AF149251_17725023e-94Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFN020J07Sequence558001575 (62)gb:AF149251_17725025e-54Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFN029N16Sequence567001575 (62)gb:AF149251_17725021e-85Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFN034H18Sequence658001575 (62)gb:AF149251_1772502e-102Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMFN039D01Sequence617001575 (62)gb:AF149251_17725023e-94Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMSF016H18Sequence464001575 (62)gb:AF149251_17725024e-63Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.729001575 (62)gb:AF149251_17725024e-99Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMSF021E19Sequence694001575 (62)gb:AF149251_1772502e-107Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.792001575 (62)gb:AF149251_17725023e-87Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMSF038K20Sequence670001575 (62)gb:AF149251_17725022e-87Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.903001575 (62)gb:AF149251_1772502e-131Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.
JMSF049O09Sequence702001575 (62)gb:AF149251_17725027e-97Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.741001575 (62)gb:AF149251_17725021e-98Nicotiana tabacum secretory peroxidase (PER) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017D08- TGGTGAGGGTCCTACTGNTC
rJMFF034E16- TTGTTCTTTTTCCATTAAAAATTTTGGTGAGGGTCCTACTGTTC
rJMSF021E19- TC
                      ____________________________________________________________
consensus TTGTTCTTTTTCCATTAAAAATTTTGGTGAGGGTCCTACTGTTC
 
. : . : . : . : . : . :
rJMFF017D08- TTGGTCATATACTTTTCATACTCCATTATCTATGGGTGCTCACATGATCCCACACTATAA
rJMFF034E16- TTGGTCATATACTTTTCATACTCCATTATCTATGGGTGCTCACATGATCCCACACTATAA
rJMSF021E19- TTGGTCATATACTTTTCATACTCCATTATCTATGGGTGCTCACATGATCCCACACTATAA
                      ____________________________________________________________
consensus TTGGTCATATACTTTTCATACTCCATTATCTATGGGTGCTCACATGATCCCACACTATAA
 
. : . : . : . : . : . :
rJMFF017D08- AAAGAGAACAGTACAGTTTANGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMFF034E16- AAAGAGAACAGTACAGTTTAAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMFF044F10- TTTAAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMFF044G09- AAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMFF044F04- TTAAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
JMFN020J07+ TTTAAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMFF043B20- AAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMFF043A06- AAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMSF021E19- AAAGAGAACAGTACAGTTTAAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
rJMFF033J22- ATTAATTTATGCTCCAAA
rJMFF019N10- ATTAATTTATGCTCCAAA
rJMFF036G03- ATTAATTTATGCTCCAAA
rJMFF035K06- ATTAATTTATGCTCCAAA
rJMFF021J18- AATTTATGCTCCAAA
rJMFF041H14- ATGCTCCAAA
rJMFF030P16- ATGCTCCAAA
rJMFF020I09- TTAATTTATGCTCCAAA
rJMFF026I23- AATTTATGCTCCAAA
rJMFF037J09- ATTAATTTATGCTCCAAA
rJMFF003K11- TAATTTATGCTCCAAA
rJMFF033N14- ATTAATTTATGCTCCAAA
rJMSF016H18- AA
rJMFF026M02- ATTTATGCTCCAAA
rJMFF002O07- TAATTTATGCTCC-AA
rJMSF049O09- ATGCTCCAAA
rJMSF038K20- AA
                      ____________________________________________________________
consensus AAAGAGAACAGTACAGTTTAAGCAAGCATAATGACCATCACCATTAATTTATGCTCCAAA
 
. : . : . : . : . : . :
rJMFF017D08- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF034E16- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAANAAATTTACAG-
rJMFF044F10- CACCAAAACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF044G09- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF044F04- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
JMFN020J07+ CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF043B20- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAAAAATTTACAG-
rJMFF043A06- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAAAAATTTACAG-
rJMSF021E19- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF033J22- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF019N10- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF036G03- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF035K06- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF021J18- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF041H14- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF030P16- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF020I09- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF026I23- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF037J09- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF003K11- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF033N14- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMSF016H18- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF026M02- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF034C23- ACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF002O07- CACCAACACCTAC-TTCCAACATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF007F09- ATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMFF039H21- ACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMSF049O09- CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
rJMSF038K20- CACCAACACCTACGTTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAGC
                      ____________________________________________________________
consensus CACCAACACCTAC-TTCCACCATACATAAACTGCAAAGCCTGAAATAAGAAATTTACAG-
 
. : . : . : . : . : . :
rJMFF017D08- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF034E16- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF044F10- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF044G09- TAAAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF044F04- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
JMFN020J07+ TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF043B20- TAAAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF043A06- TAAAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMSF021E19- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF033J22- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF019N10- TAGAACCATCGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF036G03- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF035K06- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF021J18- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF041H14- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF030P16- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF020I09- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF026I23- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF037J09- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF003K11- TAGAACCATCGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF033N14- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMSF016H18- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF026M02- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF034C23- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF002O07- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF007F09- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMFF039H21- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMSF049O09- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
rJMSF038K20- TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
                      ____________________________________________________________
consensus TAGAACCATTGAAATTAAACAACATCACCACCACTTTCTTGCCACACTATTTGAAGCTGG
 
. : . : . : . : . : . :
rJMFF017D08- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTACGCCATTAGGAAGCC
rJMFF034E16- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF044F10- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF044G09- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF044F04- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
JMFN020J07+ TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF043B20- TAAATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF043A06- TAAATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMSF021E19- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF033J22- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF019N10- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF036G03- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF035K06- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF021J18- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF041H14- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF030P16- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF020I09- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF026I23- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF037J09- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF003K11- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF033N14- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMSF016H18- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF026M02- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF034C23- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF002O07- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF007F09- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMFF039H21- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMSF049O09- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
rJMSF038K20- TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
                      ____________________________________________________________
consensus TAGATAAACAAAGTCCAGTAAGGGCAACCAACCCTCTTATTACTAGGCCATTAGGAAGCC
 
. : . : . : . : . : . :
rJMFF017D08- AAACTAGTGGAGCTTGNTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF034E16- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF044F10- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF044G09- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF044F04- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
JMFN020J07+ AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF043B20- AAACTAGTGGAGCTTGTTAGCCAAATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF043A06- AAACTAGTGGAGCTTGTTAGCCAAATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMSF021E19- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF033J22- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF019N10- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF036G03- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF035K06- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF021J18- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF041H14- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF030P16- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF020I09- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF026I23- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF037J09- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF003K11- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF033N14- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMSF016H18- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCGGT
rJMFF026M02- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF034C23- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF002O07- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF007F09- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMFF039H21- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMSF049O09- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
rJMSF038K20- AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
                      ____________________________________________________________
consensus AAACTAGTGGAGCTTGTTAGCCAGATTGCATTGCTTTCTGATCTCACCCTTGGAGCCAGT
 
. : . : . : . : . : . :
rJMFF017D08- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGNC
rJMFF034E16- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF044F10- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF044G09- GAGAGGGTTGTTCTCAAAAAGAATAGTGATGGCTCTGGAAAACTCCTTGAAGAAATAGTC
rJMFF044F04- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
JMFN020J07+ GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF043B20- GAGAGGGTTGTTCTCAAAAAAAATAGTGATGGCTCTGGAAAACTCCTTGAAAAAATAGTC
rJMFF043A06- GAGAGGGTTGTTCTCAAAAAAAATAGTGATGGCTCTGGAAAACTCCTTGAA
rJMSF021E19- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF033J22- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF019N10- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF036G03- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF035K06- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF021J18- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF041H14- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF030P16- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF020I09- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF026I23- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF037J09- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF003K11- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF033N14- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMSF016H18- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF026M02- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF034C23- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF002O07- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF007F09- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMFF039H21- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMSF049O09- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
rJMSF038K20- GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
                      ____________________________________________________________
consensus GAGAGGGTTGTTCTCAGAGAGAATAGTGATGGCTCTGGAGAACTCCTTGAAGAAATAGTC
 
. : . : . : . : . : . :
rJMFF017D08- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTANTTGGTG
rJMFF034E16- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF044F10- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF044G09- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF044F04- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
JMFN020J07+ CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF043B20- CTGATTCTTT
rJMSF021E19- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF033J22- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF019N10- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF036G03- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF035K06- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF021J18- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF041H14- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF030P16- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF020I09- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF026I23- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF037J09- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF003K11- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF033N14- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMSF016H18- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF026M02- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF034C23- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF002O07- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF007F09- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMFF039H21- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMSF049O09- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
rJMSF038K20- CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
                      ____________________________________________________________
consensus CTGATTCTTTGCCATTTTCTTGACATAAGGCTTGGTCCTCTTGTCTGTGGCTAGTTGGTG
 
. : . : . : . : . : . :
rJMFF017D08- GTCTA
rJMFF034E16- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF044F10- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF044G09- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF044F04- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
JMFN020J07+ GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMSF021E19- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF033J22- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF019N10- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF036G03- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF035K06- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF021J18- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF041H14- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF030P16- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF020I09- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF026I23- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF037J09- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF003K11- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF033N14- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMSF016H18- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF026M02- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF034C23- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF002O07- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF007F09- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMFF039H21- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMSF049O09- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
rJMSF038K20- GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
                      ____________________________________________________________
consensus GTCTACAAGCATCAACCCTTTGTTGTCCAAAATGTTCCTGTAGTAGTTGTTGTCCAGTTT
 
. : . : . : . : . : . :
rJMFF034E16- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCANGAATTGGATC
rJMFF044F10- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF044G09- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF044F04- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
JMFN020J07+ CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMSF021E19- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF033J22- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF019N10- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF036G03- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF035K06- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF021J18- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF041H14- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF030P16- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF020I09- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF026I23- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF037J09- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF003K11- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF033N14- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMSF016H18- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGTACAGCCTTTGGGTCAGGAATTGGATC
rJMFF026M02- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF034C23- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF002O07- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF007F09- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMFF039H21- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
rJMSF049O09- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAGTTGGATC
rJMSF038K20- CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
                      ____________________________________________________________
consensus CATGGGCGTGCCCCGGTCGTTCCTCACATACTGCACAGCCTTTGGGTCAGGAATTGGATC
 
. : . : . : . : . : . :
rJMFF034E16- TGGGCATTTCTTGAGCATGTGTGGAACATGATCANGGTTGAGCTGA-NGGTCCACTTCTG
rJMFF044F10- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF044G09- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGT
rJMFF044F04- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTG
JMFN020J07+ TGGGCATTTCTTGAGCATGT
rJMSF021E19- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF033J22- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF019N10- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF036G03- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF035K06- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF021J18- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF041H14- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF030P16- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF020I09- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF026I23- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF037J09- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF003K11- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF033N14- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMSF016H18- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF026M02- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF034C23- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF002O07- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF007F09- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMFF039H21- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMSF049O09- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
rJMSF038K20- TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
JMFN034H18+ TGATCAGGG-TGAGCTGAGGGGTCCACTTCTG
JMSF021E19+ AGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
JMSF049O09+ TGA-GGGTCCACTTCTG
                      ____________________________________________________________
consensus TGGGCATTTCTTGAGCATGTGTGGAACATGATCAGGGTTGAGCTGA-GGGTCCACTTCTG
 
. : . : . : . : . : . :
rJMFF034E16- GGTAT-AACCTGTGAA
rJMFF044F10- GGT
rJMSF021E19- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF033J22- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF019N10- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF036G03- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF035K06- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF021J18- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF041H14- GGTAT-AACCTGTGAACCAGCTTCACACA
rJMFF030P16- GGTAT-AACCTGTGAACCAG
rJMFF020I09- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF026I23- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF037J09- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF003K11- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF033N14- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMSF016H18- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF026M02- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF034C23- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF002O07- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF007F09- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMFF039H21- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMSF049O09- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
rJMSF038K20- GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFN034H18+ GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFF043B20+ TGTGAACCAGCTTCACACAGTGGG-TCTTCNTACACTGTGAGCTCCTAGC
JMFF044G09+ ACCTGTGAACCAGCTTCACACAGTGGG-TCTTCCTACACTGTGAGCTCCTAGC
JMFF044F10+ ACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFN014N11+ CTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFF044F04+ CTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFN039D01+ GAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFF003K11+ TAGC
JMFN029N16+ CCTAGC
JMFF036G03+ TCCTAGC
JMFF043A06+ GAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFF041H14+ CAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMFF007F09+ TCCTACACTGTGAGCTCCTAGC
JMSF021E19+ GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMSF049O09+ GGTATAAACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
JMSF038K20+ CTGTGAGCTCCTAGC
                      ____________________________________________________________
consensus GGTAT-AACCTGTGAACCAGCTTCACACAGTGGGTTCTTCCTACACTGTGAGCTCCTAGC
 
. : . : . : . : . : . :
rJMSF021E19- AAAGCAACAACTCCNGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF033J22- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF019N10- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF036G03- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF035K06- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF021J18- AAAGCAACAACTC
rJMFF020I09- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF026I23- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF037J09- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF003K11- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF033N14- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMSF016H18- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF026M02- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF034C23- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF002O07- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF007F09- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMFF039H21- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMSF049O09- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
rJMSF038K20- AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFN034H18+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF043B20+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF044G09+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF044F10+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFN014N11+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF044F04+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFN039D01+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF036J20+ CCTCTCAAGAACAAGACT
JMFF019N10+ CTCAAGAACAAGACT
JMFF003K11+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFN029N16+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF036G03+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF043A06+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF041H14+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF007F09+ AAAGCAACAACTCCAGGAGGTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF026I23+ CTCTCAAGAACAAGACT
JMFF021J18+ CAAGACT
JMFF002O07+ AGACT
JMFF016E14+ CTCAAGAACAAGACT
JMSF021E19+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMSF049O09+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
JMFF043H15+ CTCCAGGA-GTGTTGATTCCAATGTNGGAAAACCTCTCAAGAACAAGACT
JMFF037J09+ GAACAAGACT
JMSF038K20+ AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
                      ____________________________________________________________
consensus AAAGCAACAACTCCAGGA-GTGTTGATTCCAATGTTGGAAAACCTCTCAAGAACAAGACT
 
. : . : . : . : . : . :
rJMSF021E19- CATGCTGTCATTG
rJMFF033J22- CATGCTGTCATTGT-G
rJMFF019N10- CATGCTGTCATTGT-GG
rJMFF036G03- CATGCTGTCATTGT-GGTCTGGGA
rJMFF035K06- CATGCTGTCATTGT-GGTCTGGGA
rJMFF020I09- CATGCTGTCATTGT-GGTCTGGGA
rJMFF026I23- CATGCTGTCATTGT-GGTCTGGGA
rJMFF037J09- CATGCTGTCATTGT-GG
rJMFF003K11- CATGCTGTCATTGT-GG
rJMFF033N14- CATGCTGTCATTGT-GGTCTGGGAG
rJMSF016H18- CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
rJMFF026M02- CATGCTGTCATTGT-GGTCTGGGANGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
rJMFF034C23- CATGCTGTCATTGTGGGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
rJMFF002O07- CATGCTGTCATTGTGGGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
rJMFF007F09- CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
rJMFF039H21- CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
rJMSF049O09- CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
rJMSF038K20- CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFN034H18+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF043B20+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF044G09+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF044F10+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFN014N11+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF044F04+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFN039D01+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF036J20+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF019N10+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF003K11+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFN029N16+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF036G03+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF043A06+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF041H14+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF039H21+ GGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF007F09+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF026I23+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF021J18+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF002O07+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATNTGCTCTGCTCTTCCTGC
JMFF033N14+ T-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF034C23+ GGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF030P16+ TCCTGC
JMFF016E14+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMSF021E19+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMSF049O09+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF043H15+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMFF037J09+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
JMSF038K20+ CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
                      ____________________________________________________________
consensus CATGCTGTCATTGT-GGTCTGGGAGGTATTGTTCAAGAATATCTGCTCTGCTCTTCCTGC
 
. : . : . : . : . : . :
rJMSF016H18- CATCCCTTCTCCC
rJMFF026M02- CATCCCTTCTCCC
rJMFF034C23- CATCCCTTCTCCCA
rJMFF002O07- CATCCCTTCTCCCA
rJMFF007F09- CATCCCTTCTCCCAG
rJMSF049O09- CATCCCTTCTCCCAGAT
rJMSF038K20- CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFN034H18+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF043B20+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAATGCAACTATGCCATCTC
JMFF044G09+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF044F10+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFN014N11+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF044F04+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFN039D01+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF036J20+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF019N10+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF003K11+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFN029N16+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF036G03+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF043A06+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF041H14+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF039H21+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF007O18+ CCATCTN
JMFF007F09+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF026I23+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF021J18+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF002O07+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTN
JMFF033N14+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF034C23+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF030P16+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMSF016H18+ TCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF016E14+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMSF021E19+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMSF049O09+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF043H15+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF037J09+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF033J22+ CCTCCAAGTGCAACTATGCCATCTC
JMSF038K20+ CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
JMFF035K06+ CCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
                      ____________________________________________________________
consensus CATCCCTTCTCCCAGATTTGAGTGGGATGTATGGGCCTCCAAGTGCAACTATGCCATCTC
 
. : . : . : . : . : . :
rJMSF038K20- TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFN034H18+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF043B20+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF044G09+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF044F10+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFN014N11+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF044F04+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFN039D01+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF036J20+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF019N10+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF003K11+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFN029N16+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF036G03+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF043A06+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF041H14+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF039H21+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF007O18+ TAGCAGNCANCNCAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF007F09+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF026I23+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF021J18+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF002O07+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF033N14+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF034C23+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF030P16+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMSF016H18+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF016E14+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMSF021E19+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMSF049O09+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF043H15+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF037J09+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF033J22+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMSF038K20+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
JMFF035K06+ TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
                      ____________________________________________________________
consensus TAGCAGACAACACAAGAATATCAGCACAGGAAACAACTCCAGGGCACTCCCTCTCCACAG
 
. : . : . : . : . : . :
rJMSF038K20- CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFN034H18+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF043B20+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF044G09+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF044F10+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFN014N11+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF044F04+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFN039D01+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF036J20+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF019N10+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF003K11+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFN029N16+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF036G03+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF043A06+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF041H14+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF039H21+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCC-AAGCTCCTGTCTGCTTCCT
JMFF007O18+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCC-AAGCTCCTGTCTGCTTCCT
JMFF007F09+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCC-AAGCTCCTGTCTGCTTCCT
JMFF026I23+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF021J18+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF002O07+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF033N14+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF034C23+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF030P16+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMSF016H18+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF016E14+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMSF021E19+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMSF049O09+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF043H15+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF037J09+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF033J22+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMSF038K20+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
JMFF035K06+ CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
                      ____________________________________________________________
consensus CTTCCTTAATGGTCTCAATGTACCTGAAATTCCTCATCCCAAAGCTCCTGTCTGCTTCCT
 
. : . : . : . : . : . :
rJMSF038K20- TCTCA
JMFN034H18+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF043B20+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF044G09+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF044F10+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFN014N11+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF044F04+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFN039D01+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF036J20+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF019N10+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF003K11+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFN029N16+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF036G03+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF043A06+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF041H14+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF039H21+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF007O18+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF007F09+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF026I23+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF021J18+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF002O07+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF033N14+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF034C23+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF030P16+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMSF016H18+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF016E14+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMSF021E19+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMSF049O09+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF043H15+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF037J09+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF033J22+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMSF038K20+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
JMFF035K06+ TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
                      ____________________________________________________________
consensus TCTCAGACAGAACCCTCCTGGTTGAGTCCAGCAGCAGCGAAGCATCACAAGACTCAACAA
 
. : . : . : . : . : . :
JMFN034H18+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF043B20+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF044G09+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF044F10+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFN014N11+ AGCAGTCATGGAAAATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF044F04+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFN039D01+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF036J20+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF019N10+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF003K11+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFN029N16+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF036G03+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF043A06+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF041H14+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF039H21+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF007O18+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF007F09+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF026I23+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF021J18+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF002O07+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF033N14+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF034C23+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF030P16+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMSF016H18+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF016E14+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMSF021E19+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMSF049O09+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF043H15+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF037J09+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF033J22+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMSF038K20+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
JMFF035K06+ AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
                      ____________________________________________________________
consensus AGCAGTCATGGAAGATGTTCCTGAGCCAAGAAAACGCTGTGTTCTTGTGGCGCTTGTACA
 
. : . : . : . : . : . :
JMFN034H18+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFN007G21+ CTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF043B20+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF044G09+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF044F10+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFN014N11+ GGAGTTTGACTTGCTATTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF044F04+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFN039D01+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF036J20+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF019N10+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF003K11+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFN029N16+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF036G03+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF043A06+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF041H14+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF039H21+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF007O18+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF007F09+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF026I23+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF021J18+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF002O07+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF033N14+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF034C23+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF030P16+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMSF016H18+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF016E14+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMSF021E19+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMSF049O09+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF043H15+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF037J09+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF033J22+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMSF038K20+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
JMFF035K06+ GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
                      ____________________________________________________________
consensus GGAGTTTGACTTGCTCTTTGATGATGTCTTCAGCTTGAGGGCAGGTGTCTTTGTAGTAGT
 
. : . : . : . : . : . :
JMFN034H18+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFN007G21+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF043B20+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF044G09+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF044F10+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFN014N11+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF044F04+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFN039D01+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF036J20+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF019N10+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF003K11+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFN029N16+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF036G03+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF043A06+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF041H14+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF039H21+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF007O18+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF007F09+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF026I23+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF021J18+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF002O07+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF033N14+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF034C23+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF030P16+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMSF016H18+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF016E14+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMSF021E19+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMSF049O09+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF043H15+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGCGTGAGAAG
JMFF037J09+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGGGAGC-TGAGAAG
JMFF033J22+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGGGAGC-TGAGAAG
JMSF038K20+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
JMFF035K06+ TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
                      ____________________________________________________________
consensus TCATAGCAAGCCCAGAAGTCTCATGGCTGTCTTCTGCTATGGCAGAGAGAGC-TGAGAAG
 
. : . : . : . : . : . :
JMFN034H18+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTG
JMFN007G21+ AAGAGGATGGCTAAGAAGAAGAGA
JMFF043B20+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGA
JMFF044G09+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF044F10+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFN014N11+ AAGAGGATGGCTAAGAAGAAGAGAGC
JMFF044F04+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFN039D01+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAA
JMFF036J20+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCA
JMFF019N10+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCA
JMFF003K11+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCA
JMFN029N16+ AAGAGGATGGCTAAGAAGAAGAGA
JMFF036G03+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAA
JMFF043A06+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF041H14+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTT-AACCCATTTTCATGAAT
JMFF039H21+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF007O18+ AAGAGG
JMFF007F09+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF026I23+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF021J18+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF002O07+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAA
JMFF033N14+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF034C23+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMFF030P16+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAAT
JMSF016H18+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGA
JMFF016E14+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMSF021E19+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGAT
JMSF049O09+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGATAGTGTGGAT
JMFF043H15+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGATAGTGTGGAT
JMFF037J09+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGATAGTGTGGAT
JMFF033J22+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGATAGTGTGGAT
JMSF038K20+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGATAGTGTGGAT
JMFF035K06+ AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGATAGTGTGGAT
                      ____________________________________________________________
consensus AAGAGGATGGCTAAGAAGAAGAGAGCTCTTGAACCCATTTTCATGAATGATAGTGTGGAT
 
. : . : . : . : . : . :
JMSF049O09+ AATACTGAGCTTCTACTTAAGTAAGGGC
JMFF043H15+ AATACTGAGCTTCTACTTAAGTAAGGGCAGGAGAAGAGCTGAAAGTCAGTAGC
JMFF037J09+ AATACTGAGCTTCT
JMFF033J22+ AATACTGAGCTTCT
JMSF038K20+ AATACTGAGCTTCTACTTAAGTAAGGGCAGGAGAAGAGCTGAAAGTCAGTAGC
JMFF035K06+ AATACTGAGCTTCTACTTAAGTAAGGGCAGGAGAAGAGCTGAAAGTCAGTAGCATCCAAT
                      ____________________________________________________________
consensus AATACTGAGCTTCTACTTAAGTAAGGGCAGGAGAAGAGCTGAAAGTCAGTAGCATCCAAT