Previous Contig 001563:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035G15Sequence578001563 (5)sp|Q40460|RCA1_TOBAC9e-56Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplast precursor (R709011560 (4)gb:AF329935_17870934e-69Gossypium hirsutum ribulose-1,5-bisphosphate carboxylase/oxygenase activase 2 mR
JMFS101H02Sequence606001563 (5)sp|Q40460|RCA1_TOBAC3e-67Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplast precursor (R
JMSF006G23Sequence251001563 (5)sp|Q40460|RCA1_TOBAC9e-05Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplast precursor (R205011560 (4)gb:AB034698_15188641e-23Oryza sativa OsrcaA1 mRNA for RuBisCO activase large isoform precursor, complete
JMSF010E22Sequence310001563 (5)sp|Q40460|RCA1_TOBAC6e-07Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplast precursor (R751011560 (4)gb:AB034698_15188648e-81Oryza sativa OsrcaA1 mRNA for RuBisCO activase large isoform precursor, complete
JMSF039B03Sequence637001563 (5)sp|Q40460|RCA1_TOBAC2e-68Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplast precursor (R856011560 (4)gb:AB034698_15188649e-96Oryza sativa OsrcaA1 mRNA for RuBisCO activase large isoform precursor, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS101H02+ ACAAGCTCACACTGGAAAGACTTCCCTTGA
JMSF039B03+ CCGGAACACAAGCTCACACTGGAAAGACTTCCCTTGA
                      ____________________________________________________________
consensus CCGGAACACAAGCTCACACTGGAAAGACTTCCCTTGA
 
. : . : . : . : . : . :
JMFS101H02+ CCTNTGCCTCCCCAAACACCCAAGATGAGAGGAACCTTAATGTTGGGCAGTTTCAAGAAG
JMSF039B03+ CCTTTGCCTCCCCAAACACCCAAGATGAGAGGAACCTTAATGTTGGGCAGTTTCAAGAAG
JMFF035G15+ AGATGAGAGGAACCTTAATGTTGGGCAGTTTCAAGAAG
                      ____________________________________________________________
consensus CCTTTGCCTCCCCAAACACCCAAGATGAGAGGAACCTTAATGTTGGGCAGTTTCAAGAAG
 
. : . : . : . : . : . :
JMFS101H02+ TTCTTGGTGATATGGACAACAAGCTTGTCCATGAAAGCTGGGGCAATGTAAAATCCATCC
JMSF039B03+ TTCTTGGTGATATGGACAACAAGCTTGTCCATGAAAGCTGGGGCAATGTAAAATCCATCC
JMFF035G15+ TTCTTGGTGATATGGACAACAAGCTTGTCCATGAAAGCTGGGGCAATGTAAAATCCATCC
                      ____________________________________________________________
consensus TTCTTGGTGATATGGACAACAAGCTTGTCCATGAAAGCTGGGGCAATGTAAAATCCATCC
 
. : . : . : . : . : . :
JMFS101H02+ AATGTGTTATCGATATTGTATGCGCGAAGGCCCTGACTGATGTATTCGTAAGAGCTAAGG
JMSF039B03+ AATGTGTTATCGATATTGTATGCGCGAAGGCCCTGACTGATGTATTCGTAAGAGCTAAGG
JMFF035G15+ AATGTGTTATCGATATTGTATGCGCGAAGGCCCTGACTGATGTATTCGTAAGAGCTAAGG
                      ____________________________________________________________
consensus AATGTGTTATCGATATTGTATGCGCGAAGGCCCTGACTGATGTATTCGTAAGAGCTAAGG
 
. : . : . : . : . : . :
JMFS101H02+ ACAGCATGGTGAGTGCCAGTACCCATAGGAGCCTGGAAGAGAGTGTCAACCAATCCCTTT
JMSF039B03+ ACAGCATGGTGAGTGCCAGTACCCATAGGAGCCTGGAAGAGAGTGTCAACCAATCCCTTT
JMFF035G15+ ACAGCATGGTGAGTGCCAGTACCCATAGGAGCCTGGAAGAGAGTGTCAACCAATCCCTTT
                      ____________________________________________________________
consensus ACAGCATGGTGAGTGCCAGTACCCATAGGAGCCTGGAAGAGAGTGTCAACCAATCCCTTT
 
. : . : . : . : . : . :
JMFS101H02+ CCCCTCGTGATATCCTGCTGGTCATCAGAGATGTCCTCTACAAGCCCCTTCCACCTGTCC
JMSF039B03+ CCCCTCGTGATATCCTGCTGGTCATCAGAGATGTCCTCTACAAGCCCCTTCCACCTGTCC
JMSF010E22+ TCCACCTGTCC
JMFF035G15+ CCCCTCGTGATATCCTGCTGGTCATCAGAGATGTCCTCTACAAGCCCCTTCCACCTGTCC
                      ____________________________________________________________
consensus CCCCTCGTGATATCCTGCTGGTCATCAGAGATGTCCTCTACAAGCCCCTTCCACCTGTCC
 
. : . : . : . : . : . :
JMFS101H02+ TGATCGGTCTGTTTCTTCTCATCAATCTCGGGCTCAGCTGCATCGGGCGCCTCAGCTGCA
JMSF039B03+ TGATCGGTCTGTTTCTTCTCATCAATCTCGGGCTCAGCTGCATCGGGCGCCTCAGCTGCA
JMSF010E22+ TGATCGGTCTGTTTCTTCTCATCAATCTCGGGCTCAGCTGCATCGGGCGCCTCAGCTGCA
JMSF006G23+ TCAGCTGCA
JMFF035G15+ TGATCGGTCTGTTTCTTCTCATCAATCTCGGGCTCAGCTGCATCGGGCGCCTCAGCTGCA
                      ____________________________________________________________
consensus TGATCGGTCTGTTTCTTCTCATCAATCTCGGGCTCAGCTGCATCGGGCGCCTCAGCTGCA
 
. : . : . : . : . : . :
JMFS101H02+ ACCCTCATTCGCCTGCTGCTTGAGATCTTGGGCATCGCAACTCTGTGCCCACCGCTTTTC
JMSF039B03+ ACCCTCATTCGCCTGCTGCTTGAGATCTTGGGCATCGCAACTCTGTGCCCACCGCTTTTC
JMSF010E22+ ACCCTCATTCGCCTGCTGCTTGAGATCTTGGGCATCGCAACTCTGTGCCCACCGCTTTTC
JMSF006G23+ ACCNTCATTCGCCTGCTGCTTGAGATCTTGGGCATCGCAACTCTGTGCCCACCGCTTTTC
JMFF035G15+ ACCCTCATTCGCCTGCTGCTTGAGATCTTGGGCATCGCAACTCTGTGCCCACCGCTTTTC
                      ____________________________________________________________
consensus ACCCTCATTCGCCTGCTGCTTGAGATCTTGGGCATCGCAACTCTGTGCCCACCGCTTTTC
 
. : . : . : . : . : . :
JMFS101H02+ GTTAAGCCCTTCCCGAAGAAACCACTGCTGGGAACTGAACTCCCTGCACTCCCATTGTTC
JMSF039B03+ GTTAAGCCCTTCCCGAAGAAACCACTGCTGGGAACTGAACTCCCTGCACTCCCATTGTTC
JMSF010E22+ GTTAAGCCCTTCCCGAAGAAACCACTGCTGGGAACTGAACTCCCTGCACTCCCATTGTTC
JMSF006G23+ GTTAAGCCCTTCCCGAAGAAACCACTGCTGGGAACTGAACTCCCTGCACTCCCATTGTTC
JMFF035G15+ GTTAAGCCCTTCCCGAAGAAACCACTGCTGGGAACTGAACTCCCTGCACTCCCATTGTTC
                      ____________________________________________________________
consensus GTTAAGCCCTTCCCGAAGAAACCACTGCTGGGAACTGAACTCCCTGCACTCCCATTGTTC
 
. : . : . : . : . : . :
JMFS101H02+ AAACTCAACAGTGACTTGTTGACAGCTCCAATGGTGGAGACAGTGGCAGCCATTATCCTG
JMSF039B03+ AAACTCAACAGTGACTTGTTGACAGCTCCAATGGTGGAGACAGTGGCAGCCATTATCCTG
JMSF010E22+ AAACTCAACAGTGACTTGTTGACAGCTCCAATGGTGGAGACAGTGGCAGCCATTATCCTG
JMSF006G23+ AAACTCAACAGTGACTTGTTGACAGCTCCAATGGTGGAGACAGTGGCAGCCATTATCCTG
JMFF035G15+ AAACTCAACAGTGACTTGTTGACAGCTCCAATGGTGGAGACAGTGGCAGCCATTATCCTG
                      ____________________________________________________________
consensus AAACTCAACAGTGACTTGTTGACAGCTCCAATGGTGGAGACAGTGGCAGCCATTATCCTG
 
. : . : . : . : . : . :
JMFS101H02+ AAGCTGCTATGATCACTTGAAGACTGACTGA
JMSF039B03+ AAGCTGCTATGATCACTTGAAGACTGACTGAGATAACTCACAACTTGGAATTGGCTTT
JMSF010E22+ AAGCTGCTATGATCACTTGAAGACTGACTGAGATAACTCACAACTTGGAATTGGCTTT
JMSF006G23+ AAGCTGCTATGATCACTTGAAGACTGACTGAGATAACTCACAACTTGGAATTGGCTTT
JMFF035G15+ AAGCTGCTATGATCACTTGAAGACTGACTGAGATAACTCACAACTTGGAATTGGCTTTTT
                      ____________________________________________________________
consensus AAGCTGCTATGATCACTTGAAGACTGACTGAGATAACTCACAACTTGGAATTGGCTTTTT