Previous Contig 001558:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035D03Sequence588001558 (17)gb:BT002457_16360606e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655661001558 (17)gb:BT002457_16360601e-45Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFF038M23Sequence553001558 (17)gb:BT002457_16360605e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655477001558 (17)gb:BT002457_16360602e-39Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN009K09Sequence607001558 (17)gb:BT002457_16360607e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN010M23Sequence625001558 (17)gb:BT002457_16360607e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN012I12Sequence566001558 (17)gb:BT002457_16360604e-45Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN018C12Sequence570001558 (17)gb:BT002457_16360606e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN020J03Sequence618001558 (17)gb:BT002457_16360607e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN025B07Sequence628001558 (17)gb:BT002457_16360607e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN030K07Sequence545001558 (17)gb:BT002457_16360604e-45Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN033P19Sequence458001558 (17)gb:BT002457_16360605e-34Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN036L04Sequence491001558 (17)gb:BT002457_16360602e-35Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN039D20Sequence577001558 (17)gb:BT002457_16360606e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMFN039H01Sequence620001558 (17)gb:BT002457_16360607e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655
JMSF050I03Sequence666001558 (17)gb:BT002457_16360608e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655641001558 (17)gb:BT002457_16360608e-47Arabidopsis thaliana putative protein (At5g19590) mRNA, complete cds.>gb:BT00655

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035D03- GNTT
                      ____________________________________________________________
consensus GNTT
 
. : . : . : . : . : . :
JMFN012I12+ CAATAAACA
JMFN030K07+ AACAATAAACA
JMFN033P19+ AACAATAAACA
rJMFF035D03- GCTGATTGAAGCGATTAGGCATATAACATTAGAGCCATTGCGTAGTACAAACAATAAACA
JMSF050I03+ AACAATAAACA
                      ____________________________________________________________
consensus GCTGATTGAAGCGATTAGGCATATAACATTAGAGCCATTGCGTAGTACAAACAATAAACA
 
. : . : . : . : . : . :
rJMFF038M23- CAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
JMFN012I12+ TAAAGCATATATACAACAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
JMFN030K07+ TAAAGCATATATACAACAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
JMFN033P19+ TAAAGCATATATACAACAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
rJMFF035D03- TAAAGCATATATACAACAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
rJMSF050I03- ACAATAATGCATTGGTCCATCTGCTATCATAGGCAGCTAGATCTT
JMFN039H01+ AATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
JMFN025B07+ ATACAACAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
JMFN009K09+ AATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
JMSF050I03+ TAAAGCATATATACAACAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
                      ____________________________________________________________
consensus TAAAGCATATATACAACAATAATGCATT-GTCCATCTGCTATCATAGGCAGCTAGATCTT
 
. : . : . : . : . : . :
rJMFF038M23- TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMFN012I12+ TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMFN030K07+ TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMFN033P19+ TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
rJMFF035D03- TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
rJMSF050I03- TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMFN039H01+ TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMFN025B07+ TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMFN009K09+ TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMSF050I03+ TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
JMFN020J03+ ACATTTAACTT-ATTTATCAGTACATAATACATTCTGCGTCCACTATT-TGCGG
JMFN039D20+ CTATTTTGCGG
JMFF038M23+ CTATTTTGCGG
JMFN010M23+ ATTTATCAGTACATAATACATTCTGCGTCCACTATTNTGCGG
                      ____________________________________________________________
consensus TTGATTACATTTAACTTAATTTATCAGTACATAATACATTCTGCGTCCACTATTTTGCGG
 
. : . : . : . : . : . :
rJMFF038M23- AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN012I12+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN030K07+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN033P19+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
rJMFF035D03- AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
rJMSF050I03- AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN039H01+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN025B07+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN009K09+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMSF050I03+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN020J03+ AAATTA-TTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN039D20+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN018C12+ TTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFF038M23+ AAATTATTTCACAGGNTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFN010M23+ AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
JMFF035D03+ AGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
                      ____________________________________________________________
consensus AAATTATTTCACAGGCTAATTAAAATCCACAACAGATGAATCACCCTCAAGAAGAGGAGC
 
. : . : . : . : . : . :
rJMFF038M23- GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN012I12+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN030K07+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN033P19+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
rJMFF035D03- GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
rJMSF050I03- GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN039H01+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN025B07+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN009K09+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMSF050I03+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN020J03+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN039D20+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN018C12+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFF038M23+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN010M23+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
JMFN036L04+ TATTTGGCGGTGACCA
JMFF035D03+ GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
                      ____________________________________________________________
consensus GCTTGCCCTCACACTCAGGGCTCTCGTCGAAATTCTTAGAAGGGTATTTGGCGGTGACCA
 
. : . : . : . : . : . :
rJMFF038M23- TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN012I12+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN030K07+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN033P19+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
rJMFF035D03- TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
rJMSF050I03- TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN039H01+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN025B07+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN009K09+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMSF050I03+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN020J03+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN039D20+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN018C12+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFF038M23+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN010M23+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFN036L04+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
JMFF035D03+ TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
                      ____________________________________________________________
consensus TTCCAACCTCGAACACCAAGTTGTCGCCGCTGGATCTGATTCCGGTGATGCCCCACCACT
 
. : . : . : . : . : . :
rJMFF038M23- TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN012I12+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN030K07+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN033P19+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
rJMFF035D03- TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
rJMSF050I03- TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN039H01+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN025B07+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN009K09+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMSF050I03+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN020J03+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN039D20+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN018C12+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFF038M23+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN010M23+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFN036L04+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
JMFF035D03+ TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
                      ____________________________________________________________
consensus TGAAGAAAGCCCTGACGTTGATCCCGTCGAGCTCGGCCATACGATTTTCGACGATTTTCC
 
. : . : . : . : . : . :
rJMFF038M23- CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN012I12+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN030K07+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN033P19+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
rJMFF035D03- CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
rJMSF050I03- CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN039H01+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN025B07+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN009K09+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMSF050I03+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN020J03+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN039D20+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN018C12+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFF038M23+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN010M23+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFN036L04+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
JMFF035D03+ CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
                      ____________________________________________________________
consensus CCGTGATTTTCTTCGAATAAGTCGCCAGGTAGTTATCCGGCGGGAGAGTGATTCGGCACT
 
. : . : . : . : . : . :
rJMFF038M23- TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN012I12+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN030K07+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN033P19+ TGTCGTCAAGAAACAAGACGAAG
rJMFF035D03- TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
rJMSF050I03- TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN039H01+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN025B07+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN009K09+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMSF050I03+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN020J03+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN039D20+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN018C12+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFF038M23+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN010M23+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFN036L04+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
JMFF035D03+ TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
                      ____________________________________________________________
consensus TGTCGTCAAGAAACAAGACGAAGCTGCCGGTGGTCCGGTTAAGGCTGTAGCCTCGGACGT
 
. : . : . : . : . : . :
rJMFF038M23- TTGNCGGGAGAAGC
JMFN012I12+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN030K07+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGC
rJMFF035D03- TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
rJMSF050I03- TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN039H01+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN025B07+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN009K09+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMSF050I03+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN020J03+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN039D20+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN018C12+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFF038M23+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN010M23+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFN036L04+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
JMFF035D03+ TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
                      ____________________________________________________________
consensus TTGTCGGGAGAAGCCCGATGGGAAATCCGTACTTGATTAGCTCGCGGTGAGCATCGGATA
 
. : . : . : . : . : . :
JMFN012I12+ GAGTCGCTTTCGGGGTCT
rJMFF035D03- GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAG
rJMSF050I03- GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN039H01+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN025B07+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN009K09+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMSF050I03+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN020J03+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN039D20+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN018C12+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFF038M23+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN010M23+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFN036L04+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
JMFF035D03+ GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
                      ____________________________________________________________
consensus GAGTCGCTTTCGGGGTCTGATCCGGGTCGGAGCGGGAGAGAGTGAAGACAAAGGCGAGGG
 
. : . : . : . : . : . :
rJMSF050I03- CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGC
JMFN039H01+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTG
JMFN025B07+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGC
JMFN009K09+ CGATAAAAAACAAGAGCCGCTTTGC
JMSF050I03+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGC
JMFN020J03+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
JMFN039D20+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
JMFN018C12+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
JMFF038M23+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
JMFN010M23+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
JMFN036L04+ CGATAAAACCCAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
JMFF035D03+ CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
                      ____________________________________________________________
consensus CGATAAAAAACAAGAGCCGCTTTGCCATTTTCGTGTTGCGAGTATCAGTGTGCGCGAGAG
 
. : . : . : . : . : . :
JMFN020J03+ AGAAGAAGAAGAAGAAGAAAGTAGAAG
JMFN039D20+ AGAAGAAGAAGAAGAAGAAAGTAGAA
JMFN018C12+ AGAAGAAGAAGAAGAAGAAAGTAGAAGATTTTTATG
JMFF038M23+ AG
JMFN010M23+ AGAAGAAGAAGAAGAAGAAAGTAGAAGATTTTTATG
JMFN036L04+ AGAAGAAGAAGAAGAAGAAAGTAGAAGATTTTTATGGTGGAAACTGGAAAGTTGA
JMFF035D03+ AGAAGAAGAAGAAGAAGAAGGTAGAAGATTTTTATGGTGGAAACTGGAAAGTTGAGTGAG
                      ____________________________________________________________
consensus AGAAGAAGAAGAAGAAGAAAGTAGAAGATTTTTATGGTGGAAACTGGAAAGTTGAGTGAG