Previous Contig 001554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032M18Sequence566001554 (3)gb:ATAC018907_15437073e-31Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequenc808021393gb:ATAC018907_15437071e-86Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequenc
JMFF035B08Sequence476001554 (3)gb:ATAC018907_15437072e-17Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequenc
JMFN032H03Sequence641001554 (3)gb:ATAC018907_15437072e-84Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN032H03+ ACAGGGGAACGTGCAGCAAGCACCAACTTG
                      ____________________________________________________________
consensus ACAGGGGAACGTGCAGCAAGCACCAACTTG
 
. : . : . : . : . : . :
JMFN032H03+ TGAGCAGGGAATACTTCACCCTCTACTTCAAAATTTATATCACTTCCCTCTCCACTTTCT
                      ____________________________________________________________
consensus TGAGCAGGGAATACTTCACCCTCTACTTCAAAATTTATATCACTTCCCTCTCCACTTTCT
 
. : . : . : . : . : . :
JMFN032H03+ AAGACCTTCCCAAACTGCAAACCAATGTTAGATGCCGGCACTGGTATGGAGTAAATCTTT
                      ____________________________________________________________
consensus AAGACCTTCCCAAACTGCAAACCAATGTTAGATGCCGGCACTGGTATGGAGTAAATCTTT
 
. : . : . : . : . : . :
JMFN032H03+ GGTGCTTCTATATATGTTCTGACAACACCAACAGTACATTGGATCAAGAGACAGTCATCT
                      ____________________________________________________________
consensus GGTGCTTCTATATATGTTCTGACAACACCAACAGTACATTGGATCAAGAGACAGTCATCT
 
. : . : . : . : . : . :
JMFN032H03+ TTGAGGAATTCTGATGTTTCTAACTGTGTTCTTCTGTAAAAGCGCTTATAACCCCACATG
                      ____________________________________________________________
consensus TTGAGGAATTCTGATGTTTCTAACTGTGTTCTTCTGTAAAAGCGCTTATAACCCCACATG
 
. : . : . : . : . : . :
JMFN032H03+ CTACCACGATACTTGAGGGTATATGGCCCAGTCTCCAGGACCCTCCCGAAATGAGAATGA
                      ____________________________________________________________
consensus CTACCACGATACTTGAGGGTATATGGCCCAGTCTCCAGGACCCTCCCGAAATGAGAATGA
 
. : . : . : . : . : . :
JMFN032H03+ ACCTTATGCATCCCGTTGCCACTCTGATCCAACAGAGTCAACTCAAACAGCGCCCGGACA
JMFF032M18+ AACAGAGTCAACTCAAACAGCGCCCGGACA
                      ____________________________________________________________
consensus ACCTTATGCATCCCGTTGCCACTCTGATCCAACAGAGTCAACTCAAACAGCGCCCGGACA
 
. : . : . : . : . : . :
JMFN032H03+ TCAGTCGCATCACTTGCCAAAGCAATGAAAAGCGACACATAAGTAGCATTATCCTCCGCA
JMFF032M18+ TCAGTCGCATCACTTGCCAAAGCAATGAAAAGCGACACATAAGTAGCATTATCCTCCGCA
                      ____________________________________________________________
consensus TCAGTCGCATCACTTGCCAAAGCAATGAAAAGCGACACATAAGTAGCATTATCCTCCGCA
 
. : . : . : . : . : . :
JMFN032H03+ CTCTTACCATCGGGGTAAAAATAAATCGCCCAATCATACCCGCCGACGGTGAACGTCTCG
JMFF032M18+ CTCTTACCATCGGGGTAAAAATAAATCGCCCAATCATACCCGCCGACGGTGAACGTCTCG
JMFF035B08+ TACCATCGGGGTAAAAATAAATCGCCCAATCATACCCGCCGACGGTGAACGTCTCG
                      ____________________________________________________________
consensus CTCTTACCATCGGGGTAAAAATAAATCGCCCAATCATACCCGCCGACGGTGAACGTCTCG
 
. : . : . : . : . : . :
JMFN032H03+ GAGGCGACGTATTTCCCAATTCCCATGCCTTTCGACAGCGAATAGCCTTTAATCTTGAAA
JMFF032M18+ GAGGCGACGTATTTCCCAATTCCCATGCCTTTCGACAGCGAATAGCCTTTAATCTTGAAA
JMFF035B08+ GAGGCGACGTATTTCCCAATTCCCATGCCTTTCGACAGCGAATAGCCTTTAATTTTGAAA
                      ____________________________________________________________
consensus GAGGCGACGTATTTCCCAATTCCCATGCCTTTCGACAGCGAATAGCCTTTAATCTTGAAA
 
. : . : . : . : . : . :
JMFN032H03+ TCGTGCGACCCATTTATTGTCTCCGTCCTGCAGGTGGATGTAGTGGTGGTGGATTGAGCA
JMFF032M18+ TCGTGCGACCCATTTATTGTCTCCGTCCTGCAGGTGGATGTAGTGGTGGTGGATTGAGCA
JMFF035B08+ TCGTGCGACCCATTTATTGTCTCCGTCCTGCAGGTGGATGTAGTGGTGGTGGATTGAGCA
                      ____________________________________________________________
consensus TCGTGCGACCCATTTATTGTCTCCGTCCTGCAGGTGGATGTAGTGGTGGTGGATTGAGCA
 
. : . : . : . : . : . :
JMFN032H03+ GATGAAGACGC
JMFF032M18+ GATGAAGACGCTTCCGGTTGTTGAGGATCCAAACGAACCCGAAGAGTGCCCATGTATGGG
JMFF035B08+ GATGAAGACGCTTCCGGTTGTTGAGGATCCAAACGAACCCGAAGAGTGCCCATGTATGGG
                      ____________________________________________________________
consensus GATGAAGACGCTTCCGGTTGTTGAGGATCCAAACGAACCCGAAGAGTGCCCATGTATGGG
 
. : . : . : . : . : . :
JMFF032M18+ GTTTGGAGGTGATGGTTCGGTCGAATTGGGGGTGGGGGGTAGGATTTATTGGATTGGAAA
JMFF035B08+ GTTTGGAGGTGATGGTTCGGTCGAATTGGGGGTGGGGGGTAGGATTTATTGGATTGGAAA
                      ____________________________________________________________
consensus GTTTGGAGGTGATGGTTCGGTCGAATTGGGGGTGGGGGGTAGGATTTATTGGATTGGAAA
 
. : . : . : . : . : . :
JMFF032M18+ GACGAGAGAGTTTGAATCGGATTCAAAACCTAGGGTTTTGAGATGGAATTAGGGTTTAGA
JMFF035B08+ GACGAGAGAGTTTGAATCGGATTCAAAACCTAGGGTTTTGAGATGGAATTAGGGTTTAGA
                      ____________________________________________________________
consensus GACGAGAGAGTTTGAATCGGATTCAAAACCTAGGGTTTTGAGATGGAATTAGGGTTTAGA
 
. : . : . : . : . : . :
JMFF032M18+ AAAATCGGAATTAGGATGGTGAAGACAGGTCGGATACAGCGTTAGATGATCGGAGGAGAA
JMFF035B08+ AAAATCGGAATTAGGATGGTGAAGACAGGTCGGATACAGCGTTAGATGATCGGAGGAGAA
                      ____________________________________________________________
consensus AAAATCGGAATTAGGATGGTGAAGACAGGTCGGATACAGCGTTAGATGATCGGAGGAGAA
 
. : . : . : . : . : . :
JMFF032M18+ GGCAAAGAAGGAAGAAATGGAAAATTCAGGCGAGGAATTTGGAAATCTAGCAAAGT
JMFF035B08+ GGCAAAGAAGGAAGAAATGGAAAATTCAGGCGAGGAATTTGGAAATCTAGCAAAGTGAGT
                      ____________________________________________________________
consensus GGCAAAGAAGGAAGAAATGGAAAATTCAGGCGAGGAATTTGGAAATCTAGCAAAGTGAGT