Previous Contig 001548:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001O04Sequence528001548 (18)gb:AY547273_16129771e-49Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.662001548 (18)gb:AY547273_16129779e-57Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF018K10Sequence529001548 (18)gb:AY547273_16129776e-23Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.765001548 (18)gb:AY547273_16129772e-56Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF022M07Sequence435001548 (18)gb:AY547273_16129778e-09Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.771001548 (18)gb:AY547273_16129774e-57Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF029N16Sequence617001548 (18)gb:AY547273_16129775e-34Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF035A01Sequence589001548 (18)gb:AY547273_16129777e-33Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.748001548 (18)gb:AY547273_16129774e-57Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF040I16Sequence590001548 (18)gb:AY547273_16129773e-29Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.766001548 (18)gb:AY547273_16129774e-57Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF042C10Sequence653001548 (18)gb:AY547273_16129773e-42Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.590001548 (18)gb:AY547273_16129772e-45Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF043D17Sequence637001548 (18)gb:AY547273_16129773e-42Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.522001548 (18)gb:AY547273_16129772e-42Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.
JMFF049L08Sequence457001548 (18)gb:AF479309_18035222e-12Arachis hypogaea putative early light induced protein (Gsi-39) mRNA, partial cds
JMFF050D07Sequence585001548 (18)gb:AY547273_16129777e-30Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.512001548 (18)gb:AY547273_16129778e-46Lycopersicon esculentum early light inducible protein (ELIP) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043D17- ATTAATTGGACATGTTTTATTAAACATGTACACAAGAAAAGTAGAGTTCA
                      ____________________________________________________________
consensus ATTAATTGGACATGTTTTATTAAACATGTACACAAGAAAAGTAGAGTTCA
 
. : . : . : . : . : . :
rJMFF043D17- ATATATCTTTACATTATTGATATGATCTAAAATTTTTATAAAGACTTATGGCAAAGTATA
                      ____________________________________________________________
consensus ATATATCTTTACATTATTGATATGATCTAAAATTTTTATAAAGACTTATGGCAAAGTATA
 
. : . : . : . : . : . :
rJMFF043D17- TACTCAACTGATAATTTTATTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
rJMFF050D07- TACTCAACTGATAATTTTATTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
rJMFF042C10- CTCAACTGATAATTTTATTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
rJMFF035A01- ATTTTATTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
rJMFF040I16- TTATTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
rJMFF018K10- TATTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
rJMFF001O04- TTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
rJMFF022M07- TTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
                      ____________________________________________________________
consensus TACTCAACTGATAATTTTATTTGATAGATAGATATATTAACAAAAGCTTGTCTACACAAA
 
. : . : . : . : . : . :
rJMFF043D17- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
rJMFF050D07- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
rJMFF042C10- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
rJMFF035A01- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
rJMFF040I16- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
rJMFF018K10- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
rJMFF001O04- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
rJMFF022M07- ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
                      ____________________________________________________________
consensus ACACGATTCCCAGTTACAGTGGACTGGGTTTCAGACGTGCAAAAGTGGACCATTTTGAAC
 
. : . : . : . : . : . :
rJMFF043D17- ATACTCCCTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
rJMFF050D07- ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
rJMFF042C10- ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCATATCTC
rJMFF035A01- ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
rJMFF040I16- ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
rJMFF018K10- ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
rJMFF001O04- ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
JMFF049L08+ ATTCCAGATCTC
JMFF001O04+ CATAGCAAATCTGCCATTCCAGATCTC
rJMFF022M07- ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
                      ____________________________________________________________
consensus ATACTCCGTGAAAGCCAAGGCGACCAAACCCAACATAGCAAATCTGCCATTCCAGATCTC
 
. : . : . : . : . : . :
rJMFF043D17- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
rJMFF050D07- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
rJMFF042C10- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTAGAACAGCG
rJMFF035A01- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
rJMFF040I16- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
rJMFF018K10- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
rJMFF001O04- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
JMFF049L08+ AGCGTCGGCGGTCATCAACCCTTTTGTCTTGAGACTCCGCGGTCTCGCCTT-GATCAGTG
JMFF001O04+ AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
rJMFF022M07- AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
JMFF043D17+ CGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
JMFF042C10+ GTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTAGAACAGCG
JMFF029N16+ CCGTCACGCCTTGGAACAGCG
                      ____________________________________________________________
consensus AGCGTCGGCGGTCATCAACCCTTTCGACTT-CGACTCCGCCGTCACGCCTTGGAACAGCG
 
. : . : . : . : . : . :
rJMFF043D17- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
rJMFF050D07- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
rJMFF042C10- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
rJMFF035A01- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
rJMFF040I16- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
rJMFF018K10- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
rJMFF001O04- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
JMFF049L08+ GAATCACCGTCGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAGCCACGATACGCCACCGT
JMFF001O04+ GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
rJMFF022M07- GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
JMFF043D17+ GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
JMFF042C10+ GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
JMFF040I16+ CCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
JMFF029N16+ GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
JMFF050D07+ GACGCCAACG-TAGCAGCGCGGT-GAGCCCAGGAACCACGTGACGCCGCCGT
JMFF035A01+ GACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
                      ____________________________________________________________
consensus GAATCACCGACGCCAACGTTAGCAGCGCGGTGGAGCCCAGGAACCACGTGACGCCGCCGT
 
. : . : . : . : . : . :
rJMFF043D17- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
rJMFF050D07- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
rJMFF042C10- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
rJMFF035A01- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
rJMFF040I16- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
rJMFF018K10- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGTCCAGCTCCATT-CCCATCGCCGCCGCG
rJMFF001O04- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
JMFF049L08+ TGGAAATCTGAGCAAAGAGGTGGCCGCCGTTGCCCAGCTCCATT-CCCATGGCCGCCGCG
JMFF001O04+ TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
rJMFF022M07- TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
JMFF043D17+ TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
JMFF042C10+ TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
JMFF040I16+ TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATTCCCCATCGCCGCCGCG
JMFF029N16+ TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATTCCCCATCGCCGCCGCG
JMFF050D07+ TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
JMFF018K10+ TCTGAGCAAAGAGGTCGCCGCCGTTGTCCAGCTCCATT-CCCATCGCCGCCGCG
JMFF035A01+ TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
                      ____________________________________________________________
consensus TGGAAATCTGAGCAAAGAGGTCGCCGCCGTTGGCCAGCTCCATT-CCCATCGCCGCCGCG
 
. : . : . : . : . : . :
rJMFF043D17- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAA
rJMFF050D07- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
rJMFF042C10- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
rJMFF035A01- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
rJMFF040I16- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
rJMFF018K10- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
rJMFF001O04- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF049L08+ AGCCCAATCATGGCTAGCCGTCCGTGTATTCTCTCCGGCTCCGGCCCGCTGAAAGAGAAG
JMFF001O04+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
rJMFF022M07- AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF043D17+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF042C10+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF040I16+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF029N16+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF050D07+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF018K10+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
JMFF022M07+ CGGACCGCTGAAAGAGAAG
JMFF035A01+ AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
                      ____________________________________________________________
consensus AACCCAATCATGGCTAGCCGGCCGTTGATTCTCTCCGGCCCCGGACCGCTGAAAGAGAAG
 
. : . : . : . : . : . :
rJMFF050D07- ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
rJMFF042C10- ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
rJMFF035A01- ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
rJMFF040I16- ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
rJMFF018K10- ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
rJMFF001O04- ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF049L08+ ACGTCCCAGAGAGTGGTGCTAGATTTCGCCGCCACTGGGGGTGTTGGAGAAGGAGGAGGA
JMFF001O04+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
rJMFF022M07- ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF043D17+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF042C10+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF040I16+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF029N16+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF050D07+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF018K10+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF022M07+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
JMFF035A01+ ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
                      ____________________________________________________________
consensus ACGTCCCAGAGATTGGTGCTAGATTTCGCCGCCACTTTGGGTGCTGGAGAAGGAGGAGGA
 
. : . : . : . : . : . :
rJMFF050D07- GTTGGTTT
rJMFF042C10- GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
rJMFF035A01- GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
rJMFF040I16- GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
rJMFF018K10- GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
rJMFF001O04- GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF049L08+ GTTGGTTTCAGGCTCTGCGGTAGATGAATCAGTCACCGGCGTGGTGGGATGCTCTTTCCC
JMFF001O04+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
rJMFF022M07- GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF043D17+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF042C10+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF040I16+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF029N16+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF050D07+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF018K10+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF022M07+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
JMFF035A01+ GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
                      ____________________________________________________________
consensus GTTGGTTT-AGGCGCTGTGGTAGATGACTCCGTCACCGGCGTGGTTGGTTGCTCTTTCCC
 
. : . : . : . : . : . :
rJMFF042C10- AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCG
rJMFF035A01- AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
rJMFF040I16- AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
rJMFF018K10- AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
rJMFF001O04- AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF049L08+ AGCATCATCTTCAGACATGCTCCTGTCAAGAAAGCTAGGGTTCCTGTGCTCCCGCGGCAA
JMFF001O04+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
rJMFF022M07- AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF043D17+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF042C10+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF040I16+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF029N16+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF050D07+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF018K10+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF022M07+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
JMFF035A01+ AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
                      ____________________________________________________________
consensus AGCATCATCCTCAGACATGCTCCTGACAAGAAAGCTAGGGTTCCTCTGCAACCGTGGCAA
 
. : . : . : . : . : . :
rJMFF035A01- GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
rJMFF040I16- GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
rJMFF018K10- GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
rJMFF001O04- GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF049L08+ GTAGGCTGGAAGGAACAAGCTGGCTCA
JMFF001O04+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
rJMFF022M07- GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF043D17+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF042C10+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF040I16+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF029N16+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF050D07+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF018K10+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF022M07+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
JMFF035A01+ GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
                      ____________________________________________________________
consensus GTA-GCTTGAAGGAACAAACTGGCTCACCCCATTTCTGTTCTTGAAGCTGGTGACTGGGC
 
. : . : . : . : . : . :
rJMFF035A01- TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
rJMFF040I16- TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
rJMFF018K10- TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
rJMFF001O04- TTCCCAGAATTGACTGCATCACAAC
JMFF001O04+ TTCCCAGAATTGACTGCATCACAAC
rJMFF022M07- TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF043D17+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF042C10+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF040I16+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF029N16+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF050D07+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF018K10+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF022M07+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
JMFF035A01+ TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
                      ____________________________________________________________
consensus TTCCCAGAATTGACTGCATCACAACAGTTGAAGCCATGGAATCTGCAGAGATTTAACACA
 
. : . : . : . : . : . :
rJMFF035A01- GCTATATCTTCTACNAGGGTTGTAGCAGATCTAGTATACAGCTCA
rJMFF040I16- GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
rJMFF018K10- GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCANAAGCTAAGAAAGCA
rJMFF022M07- GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
JMFF043D17+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
JMFF042C10+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAGGCTAAGAAAGCA
JMFF040I16+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
JMFF029N16+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
JMFF050D07+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
JMFF018K10+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
JMFF022M07+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
JMFF035A01+ GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
                      ____________________________________________________________
consensus GCTATATCTTCTACAAGGGTTGTAGCAGATCTAGTATACAGCTCAGAAGCTAAGAAAGCA
 
. : . : . : . : . : . :
rJMFF040I16- AGATCA
rJMFF018K10- AGATCA
rJMFF022M07- AGATCAGAAT
JMFF043D17+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGAT
JMFF042C10+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTATTAT
JMFF040I16+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTATTATT
JMFF029N16+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTATTATT
JMFF050D07+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTATTATT
JMFF018K10+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTAT
JMFF022M07+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTATTATT
JMFF035A01+ AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTATTATTGG
                      ____________________________________________________________
consensus AGATCAGAATCAGAATCAGAATCTGTATGTGTATTGACTCTTCCTTGATGGTATTATTGG