Previous Contig 001545:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034P15Sequence370001545 (2)708021449gb:AY598343_16171172e-73Solanum tuberosum purple acid phosphatase 1 (PAP1) mRNA, complete cds.
JMSF007P01Sequence285001545 (2)526022240

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007P01+ AGCGAGCCGCCGGC
JMFF034P15+ GAGCCGCCGGC
                      ____________________________________________________________
consensus AGCGAGCCGCCGGC
 
. : . : . : . : . : . :
JMSF007P01+ CTTCGCCGGAGGATGTTCGAGCCGCGGAAGCTCCGCCACGGCAACCACCGCAGCCAACCA
JMFF034P15+ CTTCGCCGGAGGATGTTCGAGCCGCGGAAGCTCCGCCACGGCAACCNCCGCAGCCAACCA
                      ____________________________________________________________
consensus CTTCGCCGGAGGATGTTCGAGCCGCGGAAGCTCCGCCACGGCAACCACCGCAGCCAACCA
 
. : . : . : . : . : . :
JMSF007P01+ TAATCCTAAACTGATCCTTACTAGCACATCAATGGNCACTACACCCNTTTTATTTTTTTT
JMFF034P15+ TAATCCTAAACTGATCCTTACTAGCACATCAATGGACNCTACNCCCATTTTA-TTTTTTT
                      ____________________________________________________________
consensus TAATCCTAAACTGATCCTTACTAGCACATCAATGGACACTACACCCATTTTATTTTTTTT
 
. : . : . : . : . : . :
JMSF007P01+ TTTCTATATGAAAGTAGTCTCACCAAACTCAGTATGAATATGGTGTGTATATATATAGCG
JMFF034P15+ TTTCTATATGAAAGTAGTCTCACCAAACTCAGTATGAATATGGTGTGTATATATATAGCG
                      ____________________________________________________________
consensus TTTCTATATGAAAGTAGTCTCACCAAACTCAGTATGAATATGGTGTGTATATATATAGCG
 
. : . : . : . : . : . :
JMSF007P01+ TGCAGGCAAAAAGAAATTAGTTTTTTCTGTTCTATTTTCAAAACAGAAATTAGTTTTATT
JMFF034P15+ TGCAGGCAAAAAGAAATTAGTTTTTTCTGTTCTATTTTCAAAACAGAAATTAGTTTTATT
                      ____________________________________________________________
consensus TGCAGGCAAAAAGAAATTAGTTTTTTCTGTTCTATTTTCAAAACAGAAATTAGTTTTATT
 
. : . : . : . : . : . :
JMSF007P01+ TCGGCAAAAAACGTACTGGATATGAGAGAT
JMFF034P15+ TCGGCAAAAAACGTACTGGATATGAGAGATGAGGAATGAAGGAAGAAGAAAGAAGAAAAT
                      ____________________________________________________________
consensus TCGGCAAAAAACGTACTGGATATGAGAGATGAGGAATGAAGGAAGAAGAAAGAAGAAAAT
 
. : . : . : . : . : . :
JMFF034P15+ ATACGTGAGGTCAGAACAGAAGTTTCGCCTTTTGGAGTTTTATGATGCTTTAGAGCAGCG
                      ____________________________________________________________
consensus ATACGTGAGGTCAGAACAGAAGTTTCGCCTTTTGGAGTTTTATGATGCTTTAGAGCAGCG