Previous Contig 001534:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034I15Sequence371001534 (2)gb:AY463619_16077084e-10Arabidopsis thaliana TAF15b (TAF15b) mRNA, partial cds.703010704 (3)gb:AY075677_15678162e-49Arabidopsis thaliana AT5g58470/mqj2_60 mRNA, complete cds.>gb:AF367294_1791746 A
JMFF049K01Sequence411001534 (2)gb:AY463619_16077084e-10Arabidopsis thaliana TAF15b (TAF15b) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049K01+ ACAGGAGGTCCTTGGCCATAACCACTGCCATCTCTTCCCTGGTTACCACCA
JMFF034I15+ GGTTACCACCA
                      ____________________________________________________________
consensus ACAGGAGGTCCTTGGCCATAACCACTGCCATCTCTTCCCTGGTTACCACCA
 
. : . : . : . : . : . :
JMFF049K01+ TAAGAACTGCTTCTACCACCTCCACCACTTCCACTATCAAAACTCCCACCTCTCCCACCT
JMFF034I15+ TAAGAACTGCTTGTACCACCTCCACCACTTCCACTATCAAAACTCCCNCCTCTCCCACCT
                      ____________________________________________________________
consensus TAAGAACTGCTTGTACCACCTCCACCACTTCCACTATCAAAACTCCCACCTCTCCCACCT
 
. : . : . : . : . : . :
JMFF049K01+ CGATTATTTCCATATGAGCCACCACCACCACCACCACCTCCACCTCTGTTATAACTGTTA
JMFF034I15+ CGATTATTTCCATATGAGCCACCACCACCACCACCACCTCCACCTCTGTTATAACTGTTA
                      ____________________________________________________________
consensus CGATTATTTCCATATGAGCCACCACCACCACCACCACCTCCACCTCTGTTATAACTGTTA
 
. : . : . : . : . : . :
JMFF049K01+ CCACCTCTGCCACCACGATCATCAGTACCAGCAGGAGAAGGCTCACCACATTTGTTACAT
JMFF034I15+ CCACCTCTGCCACCACGATCATCAGTACCAGCAGGAGAAGGCTCACCACATTTGTTACAT
                      ____________________________________________________________
consensus CCACCTCTGCCACCACGATCATCAGTACCAGCAGGAGAAGGCTCACCACATTTGTTACAT
 
. : . : . : . : . : . :
JMFF049K01+ TCAACTCTTCTAGCAAAGTTCAAATTCCCACAACTTGGGTTAGGGCAACGCCAATCCCCT
JMFF034I15+ TCAACTCTTCTAGCAAAGTTCAAATTCCCACAACTTGGGTTAGGGCAACGCCAATCCCCT
                      ____________________________________________________________
consensus TCAACTCTTCTAGCAAAGTTCAAATTCCCACAACTTGGGTTAGGGCAACGCCAATCCCCT
 
. : . : . : . : . : . :
JMFF049K01+ TCCCTGCCGCTTCCACCACCGCGACCACCTCCCCTACCGCCTCCACCGCCTCCACCGCGA
JMFF034I15+ TCCCTGCCGCTTCCACCACCGCGACCACCTCCCCTACCGCCTCCACCGCCTCCACCGCGA
                      ____________________________________________________________
consensus TCCCTGCCGCTTCCACCACCGCGACCACCTCCCCTACCGCCTCCACCGCCTCCACCGCGA
 
. : . : . : . : . : . :
JMFF049K01+ CCACCACGATCACCACGATCACCTCCTTGATGTCCACCGCCGCCACCATATCCTCCACAT
JMFF034I15+ CCACCACGATCACCACGATCACCTCCTTGATGTCCACCGCCGCCACCATATCCTCCACAT
                      ____________________________________________________________
consensus CCACCACGATCACCACGATCACCTCCTTGATGTCCACCGCCGCCACCATATCCTCCACAT