Previous Contig 001528:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034F10Sequence456001528 (9)gb:OSJN00157_16958584e-07Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0013K16, complete seque747009815 (6)gb:AP003106_18247644e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P066
JMFF035L04Sequence594001528 (9)gb:AB016892_15132313e-19Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.719009815 (6)gb:ATAC011437_15432812e-40Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc
JMFS020H02Sequence627001528 (9)gb:AB016892_15132317e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.
JMFS064G05Sequence641001528 (9)gb:AB016892_15132314e-32Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.
JMFS093D02Sequence618001528 (9)gb:AB016892_15132311e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.
JMFS162B10Sequence613001528 (9)gb:AB016892_15132318e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.
JMSF022E18Sequence689001528 (9)gb:AB016892_15132314e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.711009815 (6)gb:AP003106_18247644e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P066
JMSF023N16Sequence689001528 (9)gb:AB016892_15132314e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.618009815 (6)gb:ATAC011437_15432814e-25Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequenc
JMSF024K04Sequence652001528 (9)gb:AB016892_15132312e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXF12.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS064G05+ TTCCATGGTTGTCGAGTTATCAAAATGGACAGCACTTATTATCGGATAATTATTA
                      ____________________________________________________________
consensus TTCCATGGTTGTCGAGTTATCAAAATGGACAGCACTTATTATCGGATAATTATTA
 
. : . : . : . : . : . :
JMFS064G05+ TTGTCGCCTCTGAAGTATAAATCCGACGGCATGGACACAATTTCGATTCCGTTCACAAAG
JMSF023N16+ AGTATAANTCCGACGGCATGGACACAATTTCGATTCCGTTCACAAAG
JMSF024K04+ CCGTTCACAAAG
JMFS020H02+ G
JMFS162B10+ AGTATAAATCCGACGGCATGGACACAATTTCGATTCCGTTCACAAAG
JMSF022E18+ AGTATAANTCCGACGGCATGGACACAATTTCGATTCCGTTCACAAAG
                      ____________________________________________________________
consensus TTGTCGCCTCTGAAGTATAAATCCGACGGCATGGACACAATTTCGATTCCGTTCACAAAG
 
. : . : . : . : . : . :
JMFS064G05+ GCATAAGGAGAAGGTGAGAAAGTAAGGTTCAGTTGCTGTTTATCATCAACGTTAACGATG
JMSF023N16+ GCATAAGGAGAAGGTGAGAAAGTAAGGTTCAGTTGCTGTTTATCATCAACGTTAACGATG
JMSF024K04+ GCATAAGGGGAAGGTGAGAAAGTAAGGTTCAGTTGCTGTTTATCATCAACGTTAACGATG
JMFS020H02+ GCATAAGGAGAAGGTGAGAAAGTAAGGTTCAGTGNCTGTTTATCATCAACGTTAACGATG
JMFS162B10+ GCATAAGGAGAAGGTGAGAAAGTAAGGTTCAGTTGCTGTTTATCATCAACGTTAACGATG
JMSF022E18+ GCATAAGGAGAAGGTGAGAAAGTAAGGTTCAGTTGCTGTTTATCATCAACGTTAACGATG
                      ____________________________________________________________
consensus GCATAAGGAGAAGGTGAGAAAGTAAGGTTCAGTTGCTGTTTATCATCAACGTTAACGATG
 
. : . : . : . : . : . :
JMFS064G05+ AATTCCTTTTTAATAAAAGGATCCGGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
JMSF023N16+ AATTCCTTTTTAATAAAAGGATCCGGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
JMSF024K04+ AATTCCTTTTTAATAAAAGGATCCGGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
JMFS020H02+ AATTCCTTTTTAATAAAAGGATCCGGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
JMFS162B10+ AATTCCTTTTTAATAAAAGGATCCGGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
JMSF022E18+ AATTCCTTTTTAATAAAAGGATCCGGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
JMFS093D02+ GGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
                      ____________________________________________________________
consensus AATTCCTTTTTAATAAAAGGATCCGGCGAGAATACGAAAGGGTCCGGCGAGGATACCGTG
 
. : . : . : . : . : . :
JMFS064G05+ AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
JMSF023N16+ AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
JMSF024K04+ AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
JMFS020H02+ AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
JMFS162B10+ AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
JMSF022E18+ AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
JMFS093D02+ AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
JMFF035L04+ GCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
                      ____________________________________________________________
consensus AGGAAGGCGCTGAAGTTTTTGAGCAGGGTGTAGTTGTTGGCGGTGACGGTGAAGAAAAAA
 
. : . : . : . : . : . :
JMFS064G05+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
JMSF023N16+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
JMSF024K04+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
JMFS020H02+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
JMFS162B10+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
JMSF022E18+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
JMFS093D02+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
JMFF035L04+ TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCNTGCGGCGGCGGAGTAATTGGCAGGGTAG
                      ____________________________________________________________
consensus TCGGTCTTGTTGAATCTTCTGCCGCCGCCGCCTGCGGCGGCGGAGTAATTGGCAGGGTAG
 
. : . : . : . : . : . :
JMFS064G05+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMSF023N16+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMSF024K04+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMFS020H02+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMFS162B10+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMSF022E18+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMFS093D02+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMFF035L04+ AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
JMFF034F10+ CCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
                      ____________________________________________________________
consensus AAGTAGAGGCGGAGGAACTTTTGGCCGGGGGAGACACGGAAGGAGTATGTGAGCTCGGAG
 
. : . : . : . : . : . :
JMFS064G05+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMSF023N16+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMSF024K04+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMFS020H02+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMFS162B10+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMSF022E18+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMFS093D02+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMFF035L04+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
JMFF034F10+ GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
                      ____________________________________________________________
consensus GTGAAGACACGCGCGGTGGTGAACGGAACTTGGGAGGCCAAAGGGCCTTGCTCCGCAATG
 
. : . : . : . : . : . :
JMFS064G05+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMSF023N16+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMSF024K04+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMFS020H02+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMFS162B10+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMSF022E18+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMFS093D02+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMFF035L04+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
JMFF034F10+ GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
                      ____________________________________________________________
consensus GCCGGAGAAGATAGCTCCGCCGTGTTCGTCGGCATGAATTGCAGGTAGTGGTTATCCGTA
 
. : . : . : . : . : . :
JMFS064G05+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMSF023N16+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMSF024K04+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMFS020H02+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMFS162B10+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMSF022E18+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMFS093D02+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMFF035L04+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
JMFF034F10+ TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
                      ____________________________________________________________
consensus TCCCAATCACGTCCATCTTGTGAGGTGCTCTTCGACGGCGCGCCGCAGCTCAGGAGGAAG
 
. : . : . : . : . : . :
JMFS064G05+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGG
JMSF023N16+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
JMSF024K04+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
JMFS020H02+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
JMFS162B10+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
JMSF022E18+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
JMFS093D02+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
JMFF035L04+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
JMFF034F10+ AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
                      ____________________________________________________________
consensus AACTCGGTTGCTTTATAAAGTGGCGCCGCCGCCGCAGTGGTGTCGGCTAATCTGAGAGCC
 
. : . : . : . : . : . :
JMSF023N16+ AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
JMSF024K04+ AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
JMFS020H02+ AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
JMFS162B10+ AAGAAGTGGAAGATAATGATGGGGAA
JMSF022E18+ AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
JMFS093D02+ AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
JMFF035L04+ AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
JMFF034F10+ AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
                      ____________________________________________________________
consensus AAGAAGTGGAAGATAATGATGGGGAAGGAGAGACGGAGAGCAAAGGCTAGCATGGCGGCT
 
. : . : . : . : . : . :
JMSF023N16+ ATCAACGGTGAAGTGTTAATATGTGTACGGTAGCCGGCT
JMSF024K04+ ATCAACGGTGAAGTGTTAATATGTGTACGGTAGCCGGCT
JMFS020H02+ ATCAACGGTGAAGTGTTAATATGTGT
JMSF022E18+ ATCAACGGTGAAGTGTTAATATGTGTACGGTAGCCGGCT
JMFS093D02+ ATCAACGGTGAAGTGTTAATATGTGTACGGTAGCCGGCTGGCTGCAACCTTCTCTGGTAA
JMFF035L04+ ATCAACGGTGAAGTGTTAATATGTGTACGGTAGCCGGCTGGCTGCAACCTTCTCTGGTAA
JMFF034F10+ ATCAACGGTGAAGTGTTAATATGTGTACGGTAGCCGGCTGGCTGCAACCTTCTCTGGTAA
                      ____________________________________________________________
consensus ATCAACGGTGAAGTGTTAATATGTGTACGGTAGCCGGCTGGCTGCAACCTTCTCTGGTAA
 
. : . : . : . : . : . :
JMFS093D02+ TTAGGCTTTAAAGAGAAGATAGAGTTGACTTGGAAGTCGTCG
JMFF035L04+ TTAGGCTTTAAAGAGAAGATAGAGTTGACTTGGAAGTCGTCGGATACACTGTGAATACAA
JMFF034F10+ TTAGGCTTTAAAGAGAAGATAGAGTTGACTTGGAAGTCGTCGGATACACTGTGAATACAA
                      ____________________________________________________________
consensus TTAGGCTTTAAAGAGAAGATAGAGTTGACTTGGAAGTCGTCGGATACACTGTGAATACAA