Previous Contig 001518:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033P17Sequence481001518 (7)gb:AC120508_17398005e-29Oryza sativa chromosome 3 BAC OSJNBb0021O11 genomic sequence, complete sequence.677001518 (7)gb:AC120508_17398007e-30Oryza sativa chromosome 3 BAC OSJNBb0021O11 genomic sequence, complete sequence.
JMFN018B12Sequence625001518 (7)gb:AC120508_17398003e-30Oryza sativa chromosome 3 BAC OSJNBb0021O11 genomic sequence, complete sequence.
JMSF001H08Sequence422001518 (7)gb:AC120508_17398002e-21Oryza sativa chromosome 3 BAC OSJNBb0021O11 genomic sequence, complete sequence.653001518 (7)gb:AC120508_17398007e-30Oryza sativa chromosome 3 BAC OSJNBb0021O11 genomic sequence, complete sequence.
JMSF012M24Sequence244001518 (7)gb:AC120508_17398002e-06Oryza sativa chromosome 3 BAC OSJNBb0021O11 genomic sequence, complete sequence.674001518 (7)gb:AC120508_17398007e-30Oryza sativa chromosome 3 BAC OSJNBb0021O11 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033P17- TGATGAATCTGCGCT
                      ____________________________________________________________
consensus TGATGAATCTGCGCT
 
. : . : . : . : . : . :
rJMFF033P17- AACTTTTCAATGTTTGTTGTACCAATAAACTTGCATTAGTCCTTTGGTGCATAGCACCCT
rJMSF012M24- GTGCATAGCACCCT
                      ____________________________________________________________
consensus AACTTTTCAATGTTTGTTGTACCAATAAACTTGCATTAGTCCTTTGGTGCATAGCACCCT
 
. : . : . : . : . : . :
rJMFF033P17- AAAAAATATTATATTTCCA-GTTTCCCTTCCCCACAATGCATTTGAATCAAATAACCCAA
rJMSF012M24- AAAAAATATTATATTTCCAGGTTTCCCTTCCCCACAATGCATTTGAATCAAATAACCCAA
                      ____________________________________________________________
consensus AAAAAATATTATATTTCCAGGTTTCCCTTCCCCACAATGCATTTGAATCAAATAACCCAA
 
. : . : . : . : . : . :
rJMFF033P17- TTTTTTTTAGCATAAATTGTTCAAGAGAGACACCATGAAATAAACTGGGAATTATTCATC
rJMSF012M24- TTTTTTTTAGCATAAATTGTTCAAGAGAGACACCATGAAATAAACTGGGAATTATTCATC
                      ____________________________________________________________
consensus TTTTTTTTAGCATAAATTGTTCAAGAGAGACACCATGAAATAAACTGGGAATTATTCATC
 
. : . : . : . : . : . :
rJMFF033P17- AGTCAGCAGCAAATAGTAGTATCAGAATCCAAATTCAAACCAATTCAATTCCTTCTCCCC
JMFN018B12+ TCCAAATTCAAACCAATTCAATTCCTTCTCCCC
rJMSF001H08- ATCAGAATCCAAATTCAAACCAATTCAATTCCTTCTCCCC
rJMSF012M24- AGTCAGCAGCAAATAGTAGTATCAGAATCCAAATTCAAACCAATTCAATTCCTTCTCCCC
JMFF033P17+ C
                      ____________________________________________________________
consensus AGTCAGCAGCAAATAGTAGTATCAGAATCCAAATTCAAACCAATTCAATTCCTTCTCCCC
 
. : . : . : . : . : . :
rJMFF033P17- TGATGGAATCAATCACAGCTTTGACCTTTCCATGATATCTCTGATCCTTTTTGAAGAAAA
JMFN018B12+ TGATGGAATCAATCACAGCTTTGACCTTTCCATGGTATCTCTGATCCTTTTTGAAGAAAA
rJMSF001H08- TGATGGAATCAATCACAGCTTTGACCTTTCCATGATATCTCTGATCCTTTTTGAAGAAAA
rJMSF012M24- TGATGGAATCAATCACAGCTTTGACCTTTCCATGATATCTCTGATCCTTTTTGAAGAAAA
JMFF033P17+ TGATGGAATCAATCACAGCTTTGACCTTTCCATGATATCTCTGATCCTTTTTGAAGAAAA
                      ____________________________________________________________
consensus TGATGGAATCAATCACAGCTTTGACCTTTCCATGATATCTCTGATCCTTTTTGAAGAAAA
 
. : . : . : . : . : . :
rJMFF033P17- CAGAAACAGCAGGAATGCCTTTGACCCGCAGTCGCTCCCCCAGCAGCTTGCCTATTTTTG
JMFN018B12+ CAGAAACAGCAGGAATGCCTTTGACCCGCAGTCGCTCCCCCAGCAACTTGCCTATTTTTG
rJMSF001H08- CAGAAACAGCAGGAATGCCTTTGACCCGCAGTCGCTCCCCCAGCAGCTTGCCTATTTTTG
JMSF001H08+ CAGAAACAGCAGGAATGCCTTTGACCCGCAGTCGCTCCCCCAGCAGCTTGCCTATTTTTG
rJMSF012M24- CAGAAACAGCAGGAATGCCTTTGACCCGCAGTCGCTCCCCCAGCAGCTTGCCTATTTTTG
JMFF033P17+ CAGAAACAGCAGGAATGCCTTTGACCCGCAGTCGCTCCCCCAGCAGCTTGCCTATTTTTG
                      ____________________________________________________________
consensus CAGAAACAGCAGGAATGCCTTTGACCCGCAGTCGCTCCCCCAGCAGCTTGCCTATTTTTG
 
. : . : . : . : . : . :
rJMFF033P17- CAGCAGCAGCAACATCCCGGGTGTTTTCTTTCGCTTCTATCATCCCCAACCTCAAACTCT
JMFN018B12+ CAGCAGCAGCAACATCCCGCCTGTTTTCTTTCGCTTCTATCATCCCCAACCTCAAACTCT
rJMSF001H08- CAGCAGCAGCAACATCCCGGGTGTTTTCTTTCGCTTCTATCATCCCCAACCTCAAACTCT
JMSF001H08+ CAGCAGCAGCAACATCCCGGGTGTTTTCTTTCGCTTCTATCATCCCCAACCTCAAACTCT
rJMSF012M24- CAGCAGCAGCAACATCCCGGGTGTTTTCTTTCGCTTCTATCATCCCCAACCTCAAACTCT
JMFF033P17+ CAGCAGCAGCAACATCCCGGGTGTTTTCTTTCGCTTCTATCATCCCCAACCTCAAACTCT
                      ____________________________________________________________
consensus CAGCAGCAGCAACATCCCGGGTGTTTTCTTTCGCTTCTATCATCCCCAACCTCAAACTCT
 
. : . : . : . : . : . :
rJMFF033P17- TCTCTTGTGTGCTGGCAGCTGTGGCAACTGTTGCACTTGGTGTGTGGACTACTTGAGCAT
JMFN018B12+ TCTCTTGTGTGCTGGCAGCTGTGGCAACTGTTGCACTTGGTGTGTGGACTACTTGAGCAT
rJMSF001H08- TCTCTTGTGTGCTGGCAGCTGTGGCAACTGTTGCACTTGGTGTGTGGACTACTTGAGCAT
JMSF001H08+ TCTCTTGTGTGCTGGCAGCTGTGGCAACTGTTGCACTTGGTGTGTGGACTACTTGAGCAT
rJMSF012M24- TCTCTTGTGTGCTGGCAGCTGTGGCAACTGTTGCACTTGGTGTGTGGACTACTTGAGCAT
JMSF012M24+ GCAT
JMFF033P17+ TCTCTTGTGTGCTGGCAGCTGTGGCAACTGTTGCACTTGGTGTGTGGACTACTTGAGCAT
                      ____________________________________________________________
consensus TCTCTTGTGTGCTGGCAGCTGTGGCAACTGTTGCACTTGGTGTGTGGACTACTTGAGCAT
 
. : . : . : . : . : . :
rJMFF033P17- TCACATATTTGTTGGTGAAGTGCATCCTCAAGACATAAGGTTTGAGGAACTTTGTCACTC
JMFN018B12+ TCACATACTTGTTCGTGAAGTGCATCCTCAACACATAAGGTTTGAGGAACTTTGTGACTC
rJMSF001H08- TCACATATTTGTTGGTGAAGTGCATCCTCAAGACATAAGGTTTGAGGAACTTTGTCACTC
JMSF001H08+ TCACATATTTGTTGGTGAAGTGCATCCTCAAGACATAAGGTTTGAGGAACTTTGTCACTC
rJMSF012M24- TCACATATTTGTTGGTGAAGTGCATCCTCAAGACATAAGGTTTGAGGAACTTTGTCACTC
JMSF012M24+ TCACATATTTGTTGGTGAAGTGCATCCTCAAGACATAAGGTTTGAGGAACTTTGTCACTC
JMFF033P17+ TCACATATTTGTTGGTGAAGTGCATCCTCAAGACATAAGGTTTGAGGAACTTTGTCACTC
                      ____________________________________________________________
consensus TCACATATTTGTTGGTGAAGTGCATCCTCAAGACATAAGGTTTGAGGAACTTTGTCACTC
 
. : . : . : . : . : . :
rJMFF033P17- TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTATCC
JMFN018B12+ TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTGTCC
rJMSF001H08- TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTATCC
JMSF001H08+ TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTATCC
rJMSF012M24- TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTATCC
JMSF012M24+ TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTATCC
JMFF033P17+ TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTATCC
                      ____________________________________________________________
consensus TTTCTGGTCTAACTGGTGGAGGAATAACCATTTCTGCTAAGGGGAATAAATCGATTATCC
 
. : . : . : . : . : . :
rJMFF033P17- GACAATGAAGTGAGTAGGAAAACTAACGCCGAGACTTTGAGTTGGAGATGCCGAGTGCGG
JMFN018B12+ GACCATGAAGTGAGTAGGAAAACTAACGCCG-GACTTTGAGTTGGAGATGCCGAGTGCGG
rJMSF001H08- GACAATGAAGTGAGTAGGAAAACTAACGCCGAGACTTTGAGTTGGAGATGCCGAGTGCGG
JMSF001H08+ GACAATGAAGTGAGTAGGAAAACTAACGCCGAGACTTTGAGTTGGAGATGCCGAGTGCGG
rJMSF012M24- GACAATGAAGTGAGTAGGAAAACTAACGCCGAGACTTTGAGTTGGAGATGCCGAGTGCGG
JMSF012M24+ GACAATGAAGTGAGTAGGAAAACTAACGCCGAGACTTTGAGTTGGAGATGCCGAGTGCGG
JMFF033P17+ GACAATGAAGTGAGTAGGAAAACTAACGCCGAGACTTTGAGTTGGAGATGCCGAGTGCGG
                      ____________________________________________________________
consensus GACAATGAAGTGAGTAGGAAAACTAACGCCGAGACTTTGAGTTGGAGATGCCGAGTGCGG
 
. : . : . : . : . : . :
rJMFF033P17- AGA
JMFN018B12+ AGAACCGGAGAAGCCGAGGGCGGAG
rJMSF001H08- AGAACCGGAGGAGCCGAGGGCGGAGGCCGGAGGCCGTGAGCCGGAGAAGGAAGTAAAC
JMSF001H08+ AGAACCGGAGGAGCCGAGGGCGGAGGCCGGAGGCCGTGAGCCGGAGAAGGAAGTAAAC
rJMSF012M24- AGAACCGGAGGAGCCGAGGGCGGAGGCCGGAGGCCGTGAGCCGGAGAAGGAAGTAAAC
JMSF012M24+ AGAACCGGAGGAGCCGAGGGCGGAGGCCGGAGGCCGTGAGCCGGAGAAGGAAGTAAAC
JMFF033P17+ AGAACCGGAGGAGCCGAGGGCGGAGGCCGGAGGCCGTGAGCCGGAGAAGGAAGTAAACGG
                      ____________________________________________________________
consensus AGAACCGGAGGAGCCGAGGGCGGAGGCCGGAGGCCGTGAGCCGGAGAAGGAAGTAAACGG