Previous Contig 001515:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017H19Sequence583001515 (3)gb:BT002710_16363139e-46Arabidopsis thaliana At1g69340/F10D13.28 gene, complete cds.>gb:AF372923_1792638748009793 (2)gb:AE016959_10228064e-85Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMFF033P02Sequence522001515 (3)gb:AE016959_10228068e-19Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01766009793 (2)gb:AE016959_10228069e-73Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMSF019F16Sequence541001515 (3)gb:BT002710_16363137e-39Arabidopsis thaliana At1g69340/F10D13.28 gene, complete cds.>gb:AF372923_1792638796022866gb:AE016959_10228061e-76Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019F16+ CTGCAGCCA
JMFF017H19+ GGAAGATCATATGCTTTAGTAACTTTCGCCATTCCTGTTCTGCAGCCA
                      ____________________________________________________________
consensus GGAAGATCATATGCTTTAGTAACTTTCGCCATTCCTGTTCTGCAGCCA
 
. : . : . : . : . : . :
JMSF019F16+ CCCAGTGTTGCACATTCTTCTGCAAGACCAGGTCCAGCGGCAGCATGCAGACCAGGGCTG
JMFF017H19+ CCCAGTGTTGCACATTCTTCTGCAAGACCAGGTCCAGCGGCAGCATGCAGACCAGGGCTG
JMFF033P02+ TCTGCAAGACCAGGTCCAGCGGCAGCATGCAGACCAGGGCTG
                      ____________________________________________________________
consensus CCCAGTGTTGCACATTCTTCTGCAAGACCAGGTCCAGCGGCAGCATGCAGACCAGGGCTG
 
. : . : . : . : . : . :
JMSF019F16+ CTGTGAGCTTCGTCCAAGTTCTCATTGGTTGAGTTAACTACAGCATCCACCTCAAGATTC
JMFF017H19+ CTGTGAGCTTCGTCCAAGTTCTCATTGGTTGAGTTAACTACAGCATCCACCTCAAGATTC
JMFF033P02+ CTGTGAGCTTCGTCCAAGTTCTCATTGGTTGAGTTAACTACAGCATCCACCTCAAGATTC
                      ____________________________________________________________
consensus CTGTGAGCTTCGTCCAAGTTCTCATTGGTTGAGTTAACTACAGCATCCACCTCAAGATTC
 
. : . : . : . : . : . :
JMSF019F16+ CAAGGGTCCCCTCTCCAC-AAATATATCTTCGAGTTCACCTCATGATCAACTGGAAACTT
JMFF017H19+ CAAGGGTCCCCTCTCCAC-AAATATATCTTCGAGTTCACCTCATGATCAACTGGAAACTT
JMFF033P02+ CAAGGGTCCCCTCTCCACAAAATATATCTTCGAGTTCACCTCATGATCAACTGGAAACTT
                      ____________________________________________________________
consensus CAAGGGTCCCCTCTCCAC-AAATATATCTTCGAGTTCACCTCATGATCAACTGGAAACTT
 
. : . : . : . : . : . :
JMSF019F16+ GGAAAGGATACCATCCCCATTAATCTCAGACCCAGAAGCAGGTGCCAAAGGATCTGGGAA
JMFF017H19+ GGAAAGGATACCATCCCCATTAATCTCAGACCCAGAAGCAGGTGCCAAAGGATCTGGGAA
JMFF033P02+ GGAAAGGATACCATCCCCATTAATCTCAGACCCAGAAGCAGGTGCCAAAGGATCTGGGAA
                      ____________________________________________________________
consensus GGAAAGGATACCATCCCCATTAATCTCAGACCCAGAAGCAGGTGCCAAAGGATCTGGGAA
 
. : . : . : . : . : . :
JMSF019F16+ ATATGTATTAGGAAAAGCAGGATCTTCATTCGCGTACAAGTACCTCTGCTCAGCATCAAT
JMFF017H19+ ATATGTATTAGGAAAAGCAGGATCTTCATTCGCGTACAAGAACCTCTGCTCAGCATCAAT
JMFF033P02+ ATATGTATTAGGAAAAGCAGGATCTTCATTCGCGTACAAGTACCTCTGCTCAGCATCAAT
                      ____________________________________________________________
consensus ATATGTATTAGGAAAAGCAGGATCTTCATTCGCGTACAAGTACCTCTGCTCAGCATCAAT
 
. : . : . : . : . : . :
JMSF019F16+ CCAACGGGGAACTTGATCTAGTGTCACCACAGAATCTACACTATCAGTAGGTACTCCACC
JMFF017H19+ CCAACGGGGAACTTGATCTAGTGTCACCACAGAATCTACACTATCAGTAGGTACTCCACC
JMFF033P02+ CCAACGGGGAACTTGATCTAGTGTCACCACAGAATCTACACTATCAGTAGGTACTCCACC
                      ____________________________________________________________
consensus CCAACGGGGAACTTGATCTAGTGTCACCACAGAATCTACACTATCAGTAGGTACTCCACC
 
. : . : . : . : . : . :
JMSF019F16+ CCGGTTGGTGGTGGCTGCCCCAGGCCGATACATATTTAGCTACTGCTACTCAAATCTCTG
JMFF017H19+ CCGGTTGGTGGTGGCTGCCCCAGGCCGATACATATTTAGCTACTGCTACTCAAATCTCTG
JMFF033P02+ CCGGTTGGTGGTGGCTGCCCCAGGCCGATACATATTTAGCTACTGCTACTCAAATCTCTG
                      ____________________________________________________________
consensus CCGGTTGGTGGTGGCTGCCCCAGGCCGATACATATTTAGCTACTGCTACTCAAATCTCTG
 
. : . : . : . : . : . :
JMSF019F16+ CCTCTTTTTACTCTTTCCAAAATCGCTCTTTCCCT
JMFF017H19+ CCTCTTTTTACTCTTTCCAAAATCGCTCTTTCCCT
JMFF033P02+ CCTCTTTTTACTCTTTCCAAAATCGCTCTTTCCCTGTAATTAAGATTCGCAGGAGGAGAA
                      ____________________________________________________________
consensus CCTCTTTTTACTCTTTCCAAAATCGCTCTTTCCCTGTAATTAAGATTCGCAGGAGGAGAA
 
. : . : . : . : . : . :
JMFF033P02+ GATTGAGCTGAGCTATGAATCTGTGATGGAGGAAGATAGGGCCTAGGGGCGTACCGAAAC
                      ____________________________________________________________
consensus GATTGAGCTGAGCTATGAATCTGTGATGGAGGAAGATAGGGCCTAGGGGCGTACCGAAAC