Previous Contig 001513:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030O10Sequence515001513 (11)gb:CLU89494_16479119e-24Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c693007302 (13)gb:AB126259_15282622e-83Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMFF031H09Sequence562001513 (11)gb:CLU89494_16479112e-32Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c767007302 (13)gb:AB126259_15282624e-94Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMFF033O22Sequence540001513 (11)gb:CLU89494_16479119e-28Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c119021416
JMFF043O07Sequence643001513 (11)gb:CLU89494_16479115e-40Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c607007302 (13)gb:AB126259_15282621e-63Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF004P07Sequence250001513 (11)
JMSF005C21Sequence388001513 (11)pir|S22465|XNYLB7e-08aspartate transaminase (EC 2.6.1.1) precursor - narrow-leaved blue lupine (fragm463007302 (13)gb:AB126259_15282621e-47Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF006J20Sequence332001513 (11)203011338 (4)
JMSF016P15Sequence446001513 (11)gb:CLU89494_16479111e-32Canavalia lineata aspartate aminotransferase 2 precursor (AAT2) mRNA, complete c758007302 (13)gb:AB126259_1528262e-102Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF043P13Sequence783001513 (11)gb:CLJ001360_16478484e-78Canavalia lineata gene for aspartate aminotransferase 2.679007302 (13)gb:AB126259_15282621e-65Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF044H08Sequence794001513 (11)gb:CLJ001360_16478481e-83Canavalia lineata gene for aspartate aminotransferase 2.786007302 (13)gb:AB126259_15282626e-98Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.
JMSF046M09Sequence805001513 (11)gb:S60967_17043377e-65Glycine max aspartate aminotransferase isozyme 5 mRNA, complete cds; chloroplast789007302 (13)gb:AB126259_15282622e-87Nicotiana tabacum mRNA for aspartate aminotransferase, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044H08+ TTCAA
                      ____________________________________________________________
consensus TTCAA
 
. : . : . : . : . : . :
JMSF044H08+ AATCCAAACCAACTGTTTTTGGATCATAATAGCGATATTCAGACCAGGGTACTCTGGCAT
                      ____________________________________________________________
consensus AATCCAAACCAACTGTTTTTGGATCATAATAGCGATATTCAGACCAGGGTACTCTGGCAT
 
. : . : . : . : . : . :
JMSF044H08+ CATTGAAAATATTCTTGTGATTACCCCATGTTGGAGATGATATCAGAACTTTTGAGCCAG
JMSF043P13+ ACCCCATGTNGGAGATGATATCAGAACTTTTGAGCCAG
JMSF046M09+ ACCCCATGTTGGAGATGATATCAGAACTTTTGAGCCAG
                      ____________________________________________________________
consensus CATTGAAAATATTCTTGTGATTACCCCATGTTGGAGATGATATCAGAACTTTTGAGCCAG
 
. : . : . : . : . : . :
JMSF044H08+ GGAAATAACGCTCTATCAGTGCTGCTGCAAGTCTTAAGGATCCAGTTCCTGAAAGACCCT
JMSF043P13+ GGAAATAACGCTCTATCAGTGCTGCTGCAAGTCTTAAGGATCCAGTTCCTGAAAGACCCT
JMSF046M09+ GGAAATAACGCTCTATCAGTGCTGCTGCAAGTCTTAAGGATCCAGTTCCTGAAAGACCCT
                      ____________________________________________________________
consensus GGAAATAACGCTCTATCAGTGCTGCTGCAAGTCTTAAGGATCCAGTTCCTGAAAGACCCT
 
. : . : . : . : . : . :
JMSF044H08+ GAACAGTTGCAACCCTTTTTTGTTGAATCACTTCATTGTCAGCACCAAACAACAACTCTG
JMSF043P13+ GAACAGTTGCAACCCTTTTTTGTTGAATCACTTCATTGTCAGCACCAAACAACAACTCTG
JMSF046M09+ GAACAGTTGCAACCCTTTTTTGTTGAATCACTTCATTGTCAGCACCAAACAACAACTCTG
JMFF043O07+ GTTGCAACCCTTTTTGTNNGAATCACTTCATTGTCAGCACCAAACAACAACTCTG
                      ____________________________________________________________
consensus GAACAGTTGCAACCCTTTTTTGTTGAATCACTTCATTGTCAGCACCAAACAACAACTCTG
 
. : . : . : . : . : . :
JMSF016P15+ GGAAGATACTCTTTGTTTTCTCCCC
JMSF044H08+ CAGTGACTTTGTTGAAGGCAGCCAAACCTTCTATTGGAAGATACTCTTTGTTTTCTCCCC
JMSF043P13+ CAGTGACTTTGTTGAAGGCAGCCAAACCTTCTATTGGAAGATACTCTTTGTTTTCTCCCC
JMSF046M09+ CAGTGACTTTGTTGAAGGCAGCCAAACCTTCTATTGGAAGATACTCTTTGTTTTCTCCCC
JMFF043O07+ CAGTGACTTTG-TGAAGGCAGCCAAACCTTCTATTGGAAGATACTCTTTGTTTTCTCCCC
JMFF031H09+ GAAGATACTCTTTGTTTTCTCCCC
                      ____________________________________________________________
consensus CAGTGACTTTGTTGAAGGCAGCCAAACCTTCTATTGGAAGATACTCTTTGTTTTCTCCCC
 
. : . : . : . : . : . :
JMSF016P15+ TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
JMSF044H08+ TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
JMSF043P13+ TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
JMSF046M09+ TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
JMFF043O07+ TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
JMFF031H09+ TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
JMFF030O10+ TTCTTGACAACATCAAGAACATAAGGCTGAAGTTCCT
JMFF033O22+ TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
                      ____________________________________________________________
consensus TCTGTAGCATAAGGTTCTCAGCCTTCTTGACAACATCAAGAACATAAGGTTGAAGTTCCT
 
. : . : . : . : . : . :
JMSF016P15+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
JMSF044H08+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
JMSF043P13+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
JMSF046M09+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
JMFF043O07+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATCTCATCAGTATCAGCCTTGAATG
JMSF005C21+ G
JMFF031H09+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
JMFF030O10+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
JMFF033O22+ CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
                      ____________________________________________________________
consensus CAGTACGGTATGCTCCAACTCCAAGATTAAGTTTCATTTCATCAGTATCAGCCTTGAATG
 
. : . : . : . : . : . :
JMSF016P15+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMSF044H08+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMSF043P13+ CTTCAGATACTCCAAGGATGGGGTCAGGCGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMSF046M09+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMFF043O07+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMSF005C21+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMSF006J20+ AACGAGAAA
JMSF004P07+ AACGAGAAA
JMFF031H09+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMFF030O10+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
JMFF033O22+ CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
                      ____________________________________________________________
consensus CTTCAGATACTCCAAGGATGGGGTCAGGTGGAGCCATTGAAATGCCCTCAAAACGAGAAA
 
. : . : . : . : . : . :
JMSF016P15+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMSF044H08+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMSF043P13+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMSF046M09+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMFF043O07+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMSF005C21+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMSF006J20+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMSF004P07+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMFF031H09+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMFF030O10+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
JMFF033O22+ CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
                      ____________________________________________________________
consensus CATTAACAGTGGCTACCATTCTCATTCGACCATGAGACTTTGTCGCGTTGCCAAAAAGCG
 
. : . : . : . : . : . :
JMSF016P15+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMSF044H08+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMSF043P13+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMSF046M09+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMFF043O07+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMSF005C21+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMSF006J20+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMSF004P07+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMFF031H09+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMFF030O10+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
JMFF033O22+ TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
                      ____________________________________________________________
consensus TGCACTGGCCATACTCGCGAAGCTTCGGTTTAGCCTTTAGCTTATCCTGCAAAGACAGCG
 
. : . : . : . : . : . :
JMSF016P15+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMSF044H08+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMSF043P13+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMSF046M09+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMFF043O07+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMSF005C21+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMSF006J20+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMSF004P07+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMFF031H09+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMFF030O10+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
JMFF033O22+ AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
                      ____________________________________________________________
consensus AAACCGATGGAGAAGCAGAGGCGAGAGTGAACACCGTAGAAGCCATCGTAATCGGAGAAG
 
. : . : . : . : . : . :
JMSF016P15+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMSF044H08+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMSF043P13+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMSF046M09+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMFF043O07+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMSF005C21+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMSF006J20+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMSF004P07+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMFF031H09+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMFF030O10+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
JMFF033O22+ GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
                      ____________________________________________________________
consensus GAGAGTTTTGCAGGAAAAGGAAGACAGAGGGACTAGTCTCAGCGATACAAACGAAGCTTC
 
. : . : . : . : . : . :
JMSF044H08+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMSF043P13+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMSF046M09+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMFF043O07+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMSF005C21+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMSF006J20+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMFF031H09+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMFF030O10+ ACACTCCCGTCAGCTTCTTCTTCTTCCTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
JMFF033O22+ ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
                      ____________________________________________________________
consensus ACACTCCCGTCAGCTTCTTCTTCTTCTTATTCTTCTTCTTCTTCAGATGCTCTCTGCCTA
 
. : . : . : . : . : . :
JMSF044H08+ CTACTCT
JMSF043P13+ CTACTCTCGAGTCTCGACAC
JMSF046M09+ CTACTCTCGAGTCTCGACACGTAGGTAT
JMFF043O07+ CTACTCTCGAGTCTCGACACGTAGGTATGAAATGCACTTTACTCTCTAT
JMSF005C21+ CTACTCTCGAGTCTCGACACGTAGGT
JMSF006J20+ CTACTCTCGAGTCTCGACAC
JMFF031H09+ CTACTCTCGAGTCTCGACACGTAGGTATGAAATGCACTTTACTCTCTATAGATAAATT
JMFF030O10+ CTACTCTCGAGTCTCGACACGTAGGTATGAAATGCACTTTACTCTCTATAGATAAATT
JMFF033O22+ CTACTCTCGAGTCTCGACACGTAGGTATGAAATGCACTTTACTCTCTATAGATAAATTAT
                      ____________________________________________________________
consensus CTACTCTCGAGTCTCGACACGTAGGTATGAAATGCACTTTACTCTCTATAGATAAATTAT