Previous Contig 001507:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033M05Sequence575001507 (2)pir|T00573|T005738e-20hypothetical protein At2g39650 [imported] - Arabidopsis thaliana>gb:AC003674_153
JMFF048B01Sequence349001507 (2)327021802

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033M05+ CTAGGATTTTCCCATATCCCTGCCACTTGGCTGTG
                      ____________________________________________________________
consensus CTAGGATTTTCCCATATCCCTGCCACTTGGCTGTG
 
. : . : . : . : . : . :
JMFF033M05+ CATATAGCCGCATCATAGCCAGAAGACTGCAGAAGCTTCATGAGACAAAACCTGATGCAG
                      ____________________________________________________________
consensus CATATAGCCGCATCATAGCCAGAAGACTGCAGAAGCTTCATGAGACAAAACCTGATGCAG
 
. : . : . : . : . : . :
JMFF033M05+ CTAGCATTGCAAGTCTCGGACTTGCATGATTGGCAGGTATCAGTTATGGAGAGAATCAAG
                      ____________________________________________________________
consensus CTAGCATTGCAAGTCTCGGACTTGCATGATTGGCAGGTATCAGTTATGGAGAGAATCAAG
 
. : . : . : . : . : . :
JMFF033M05+ GAATGAACCACCATTGTTAAGTCACTTTCAAACTGGTCACATGAGTGCTTGTACATCAAA
                      ____________________________________________________________
consensus GAATGAACCACCATTGTTAAGTCACTTTCAAACTGGTCACATGAGTGCTTGTACATCAAA
 
. : . : . : . : . : . :
JMFF048B01+ CAGCAAGATCGTAATAATAAGAATCTCCGTCGCTGCTAAGCCACGACTCCGCT
JMFF033M05+ ATCTTATCAGCAAGATCGTAATAATAAGAATCTCCGTCGCTGCTAAGCCACGACTCCGCT
                      ____________________________________________________________
consensus ATCTTATCAGCAAGATCGTAATAATAAGAATCTCCGTCGCTGCTAAGCCACGACTCCGCT
 
. : . : . : . : . : . :
JMFF048B01+ CCGGCGCTGCTACTCTCCAGGAAATCGCTAACCAAAGCGGCCAAGTCGGGTTCACTTTCG
JMFF033M05+ CCGGCGCTGCTACTCTCCAGGAAATCGCTAACCAAAGCGGCCAAGTCGGGTTCACTTTCG
                      ____________________________________________________________
consensus CCGGCGCTGCTACTCTCCAGGAAATCGCTAACCAAAGCGGCCAAGTCGGGTTCACTTTCG
 
. : . : . : . : . : . :
JMFF048B01+ TGACTAAAACACCCGCCGGCGGACCTGTCCAGCCAGTTTTTGGCGGTCCAATCAAGTCCT
JMFF033M05+ TGACTAAAACACCCGCCGGCGGACCTGTCCAGCCAGTTTTTGGCGGTCCAATCAAGTCCT
                      ____________________________________________________________
consensus TGACTAAAACACCCGCCGGCGGACCTGTCCAGCCAGTTTTTGGCGGTCCAATCAAGTCCT
 
. : . : . : . : . : . :
JMFF048B01+ CCTCCTCCTCCTCTGGCGCCACCACTTACAGCCACGGCGGCTCGGGGTTCGTGGATCAAC
JMFF033M05+ CCTCCTCCTCCTCTGGCGCCACCACTTACAGCCACGGCGGCTCGGGGTTCGTGGATCAAC
                      ____________________________________________________________
consensus CCTCCTCCTCCTCTGGCGCCACCACTTACAGCCACGGCGGCTCGGGGTTCGTGGATCAAC
 
. : . : . : . : . : . :
JMFF048B01+ ATGTGCACGAGCAAAGTATCGACGACCAACAAAAAGCTAGCTAATTTGATGTTGGAAATA
JMFF033M05+ ATGTGCACGAGCAAAGTATCGACGACCAACAAAAAGCTAGCTAATTTGATGTTGGAAATA
                      ____________________________________________________________
consensus ATGTGCACGAGCAAAGTATCGACGACCAACAAAAAGCTAGCTAATTTGATGTTGGAAATA
 
. : . : . : . : . : . :
JMFF048B01+ GTAACAGAGAATTTGAAAATTTGAAAACTGCGGTTTGGGAAGGCGATGGAGAGGAA
JMFF033M05+ GTAACAGAGAATTTGAAAATTTGAAAATGGCGGTTTGGGAAGGCGATGGAGAGGAAAGAC
                      ____________________________________________________________
consensus GTAACAGAGAATTTGAAAATTTGAAAATTGCGGTTTGGGAAGGCGATGGAGAGGAAAGAC