Previous Contig 001503:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033I16Sequence632001503 (3)gb:BT010912_16408586e-17Arabidopsis thaliana At1g48200 gene, complete cds.>gb:BT010953_1640899 Arabidops665001503 (3)gb:BT010912_16408587e-17Arabidopsis thaliana At1g48200 gene, complete cds.>gb:BT010953_1640899 Arabidops
JMSF016P23Sequence240001503 (3)gb:BT010912_16408581e-08Arabidopsis thaliana At1g48200 gene, complete cds.>gb:BT010953_1640899 Arabidops694022746

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033I16- GGCCT
                      ____________________________________________________________
consensus GGCCT
 
. : . : . : . : . : . :
rJMFF033I16- TCACATCTTCATGTAATTAAATAAATTGTACTCGGGTACTAGAGAATGAACAAGGAAAGT
JMFF033I16+ GTACTCGGGTACTAGAGAATGAACAAGGAAAGT
                      ____________________________________________________________
consensus TCACATCTTCATGTAATTAAATAAATTGTACTCGGGTACTAGAGAATGAACAAGGAAAGT
 
. : . : . : . : . : . :
rJMFF033I16- GGCCCATTGGGGCAGGGGTAGCACTACAAGAATACAAGAGGACAAATTTAGTTGATGCAT
JMFF033I16+ GGCCCATTGGGGCAGGGGTAGCACTACAAGAATACAAGAGGACAAATTTAGTTGATGCAT
                      ____________________________________________________________
consensus GGCCCATTGGGGCAGGGGTAGCACTACAAGAATACAAGAGGACAAATTTAGTTGATGCAT
 
. : . : . : . : . : . :
rJMFF033I16- GCTGCAATGATTTTGATTATTGGTGCAACTTTGGTAGATATTTGACAGATCAGTGATACT
JMFF033I16+ GCTGCAATGATTTTGATTATTGGTGCAACTTTGGTAGATATTTGACAGATCAGTGATACT
                      ____________________________________________________________
consensus GCTGCAATGATTTTGATTATTGGTGCAACTTTGGTAGATATTTGACAGATCAGTGATACT
 
. : . : . : . : . : . :
rJMFF033I16- CGGACAGTTTAGCTGTAAAGTGTAACCTAGCAAGAATATTAGTCCTTCTGCACTGGGTCA
JMFF033I16+ CGGACAGTTTAGCTGTAAAGTGTAACCTAGCAAGAATATTAGTCCTTCTGCACTGGGTCA
                      ____________________________________________________________
consensus CGGACAGTTTAGCTGTAAAGTGTAACCTAGCAAGAATATTAGTCCTTCTGCACTGGGTCA
 
. : . : . : . : . : . :
rJMFF033I16- CTGGGGTCACCAATAACACACTTCAGATTATAAATCTTGAACCTGGTGCTTTACCATCTC
JMFF033I16+ CTGGGGTCACCAATAACACACTTCAGATTATAAATCTTGAACCTGGTGCTTTACCATCTC
                      ____________________________________________________________
consensus CTGGGGTCACCAATAACACACTTCAGATTATAAATCTTGAACCTGGTGCTTTACCATCTC
 
. : . : . : . : . : . :
rJMFF033I16- CCTTAGAATTTCCATCGGCAGGGGCGGCGGTGTCTTGATCACCGTATATGGCTTTGAGCT
JMFF033I16+ CCTTAGAATTTCCATCGGCAGGGGCGGCGGTGTCTTGATCACCGTATATGGCTTTGAGCT
                      ____________________________________________________________
consensus CCTTAGAATTTCCATCGGCAGGGGCGGCGGTGTCTTGATCACCGTATATGGCTTTGAGCT
 
. : . : . : . : . : . :
rJMFF033I16- TGGAGAGGGGGACGAGGGCGCGAGAGGAGAGAGCCTCGGCCTCAGCGTAGAGCTGCTGCT
JMSF016P23+ CAGCGTAGAGCTGCTGCT
JMFF033I16+ TGGAGAGGGGGACGAGGGCGCGAGAGGAGAGAGCCTCGGCCTCAGCGTAGAGCTGCTGCT
                      ____________________________________________________________
consensus TGGAGAGGGGGACGAGGGCGCGAGAGGAGAGAGCCTCGGCCTCAGCGTAGAGCTGCTGCT
 
. : . : . : . : . : . :
rJMFF033I16- TCCAGTCCCACATGGTCTTCCTCATTTCCTTGTTGGATTTAAGCAGAGCGTTCTTCTCCG
JMSF016P23+ TCCAGTCCCACATGGTCTTCCTCATTTCCTTGTTGGATTTAAGCAGAGCGTTCTTCTCCG
JMFF033I16+ TCCAGTCCCACATGGTCTTCCTCATTTCCTTGTTGGATTTAAGCAGAGCGTTCTTCTCCG
                      ____________________________________________________________
consensus TCCAGTCCCACATGGTCTTCCTCATTTCCTTGTTGGATTTAAGCAGAGCGTTCTTCTCCG
 
. : . : . : . : . : . :
rJMFF033I16- CCTCCAACGCCTCGATATCCCATTGATGCTTCAACGACCTAGCACTCAGCGCCCCGAATA
JMSF016P23+ CCTCCAACGCCTCGATATCCCATTGATGCTTCAACGACCTAGCACTCAGCGCCCCGAATA
JMFF033I16+ CCTCCAACGCCTCGATATCCCATTGATGCTTCAACGACCTAGCACTCAGCGCCCCGAATA
                      ____________________________________________________________
consensus CCTCCAACGCCTCGATATCCCATTGATGCTTCAACGACCTAGCACTCAGCGCCCCGAATA
 
. : . : . : . : . : . :
rJMFF033I16- CGCTCAGCAGAAACAAGTTCACCACCGTGTTGCTGCTCGCCGCCCTGTTCACGGCGGTTA
JMSF016P23+ CGCTCAGCAGAAACAAGTTCACCACCGTGTTGCTGCTCGCCGCCCTGTTCACGGCGGTTA
JMFF033I16+ CGCTCAGCAGAAACAAGTTCACCACCGTGTTGCTGCTCGCCGCCCTGTTCACGGCGGTTA
                      ____________________________________________________________
consensus CGCTCAGCAGAAACAAGTTCACCACCGTGTTGCTGCTCGCCGCCCTGTTCACGGCGGTTA
 
. : . : . : . : . : . :
rJMFF033I16- TTGCCCTCCTCCATTTCGGTTTTCCTCTTTCCTTTCACCACCGGGAATCACTAATCATAT
JMSF016P23+ TTGCCCT-CTCCATTTCGGTTTTCCTCTTTCCTTTCACCACC
JMFF033I16+ TTGCCCT-CTCCATTTCGGTTTTCCTCTTTCCTTTCACCACCGGGAATCACTAATCATAT
                      ____________________________________________________________
consensus TTGCCCT-CTCCATTTCGGTTTTCCTCTTTCCTTTCACCACCGGGAATCACTAATCATAT