Previous Contig 001498:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033G22Sequence555001498 (2)sp|P35685|RL7A_ORYSA1e-3960S ribosomal protein L7a.>pir|S38360|S38360 ribosomal protein L7a, cytosolic - 770004542 (17)sp|P35685|RL7A_ORYSA3e-9060S ribosomal protein L7a.>pir|S38360|S38360 ribosomal protein L7a, cytosolic -
JMFF033I01Sequence349001498 (2)pir|T48076|T480761e-1160S RIBOSOMAL PROTEIN L7A protein - Arabidopsis thaliana>gb:ATF26K9_1550134 Arab618004542 (17)sp|P35685|RL7A_ORYSA5e-8360S ribosomal protein L7a.>pir|S38360|S38360 ribosomal protein L7a, cytosolic -

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033G22+ GCTCAATGAGGTAAG
                      ____________________________________________________________
consensus GCTCAATGAGGTAAG
 
. : . : . : . : . : . :
JMFF033G22+ TGACATGCTTGAGCCCATACTTAACAACAATAGGCTTCTTTAGTTCAGGAGTCTTTCCCT
                      ____________________________________________________________
consensus TGACATGCTTGAGCCCATACTTAACAACAATAGGCTTCTTTAGTTCAGGAGTCTTTCCCT
 
. : . : . : . : . : . :
JMFF033G22+ CACTTTCAGCCTGGGCCCTTTTCAAAAGGCGCTCCTTCTTAGCAGCCTTATCCTCAGGCC
                      ____________________________________________________________
consensus CACTTTCAGCCTGGGCCCTTTTCAAAAGGCGCTCCTTCTTAGCAGCCTTATCCTCAGGCC
 
. : . : . : . : . : . :
JMFF033G22+ TGTACTTGAGAAGCATCTTGAAGAGATTCGTTGCTAAGTTCTTATCAAGGGTCTTGGAAA
                      ____________________________________________________________
consensus TGTACTTGAGAAGCATCTTGAAGAGATTCGTTGCTAAGTTCTTATCAAGGGTCTTGGAAA
 
. : . : . : . : . : . :
JMFF033I01+ GAGTGCTGGCGGGACCTTCAAGCGCTGCTTGAGGATCCTCCTCTTCCTCNGGA
JMFF033G22+ ACTGGTTGAGTGCTGGCGGGACCTTCAAGCGCTGCTTGAGGATCCTCCTCTTCCTCTGGA
                      ____________________________________________________________
consensus ACTGGTTGAGTGCTGGCGGGACCTTCAAGCGCTGCTTGAGGATCCTCCTCTTCCTCTGGA
 
. : . : . : . : . : . :
JMFF033I01+ TGCGAACAACTTGCGGCCATTTGACGAACCTTGTAAGATCNTTNTTGGGCGGCAATGCAC
JMFF033G22+ TGCGAACAACTTGCGGCCATTTGACGAACCTTGTAAGATCCTTCTTGGGCGGCAATGCAC
                      ____________________________________________________________
consensus TGCGAACAACTTGCGGCCATTTGACGAACCTTGTAAGATCCTTCTTGGGCGGCAATGCAC
 
. : . : . : . : . : . :
JMFF033I01+ CTCCGATTCCAAATTGCTTTGGCCGCTTCTCAAAAAGCGGGTTCACCACCTTCTCCGGCT
JMFF033G22+ CTCCGATTCCAAATTGCTTTGGCCGCTTCTCAAAAAGCGGGTTCACCACCTTCTCCGGCT
                      ____________________________________________________________
consensus CTCCGATTCCAAATTGCTTTGGCCGCTTCTCAAAAAGCGGGTTCACCACCTTCTCCGGCT
 
. : . : . : . : . : . :
JMFF033I01+ TCTTCTTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTCCTCGGAACCC
JMFF033G22+ TCTTCTTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTCCTCGGAACCC
                      ____________________________________________________________
consensus TCTTCTTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTCCTCGGAACCC
 
. : . : . : . : . : . :
JMFF033I01+ GGCCTCCTTTTGTTTGAAACGTTGACGTTTTGATGGATGGTCTCCGCCATTGTTGCACAG
JMFF033G22+ GGCCTCCTTTTGTTTGAAACGTTGACGTTTTGATGGATGGTCTCCGCCATTGTTGCACAG
                      ____________________________________________________________
consensus GGCCTCCTTTTGTTTGAAACGTTGACGTTTTGATGGATGGTCTCCGCCATTGTTGCACAG
 
. : . : . : . : . : . :
JMFF033I01+ AAATCGCAAGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGA
JMFF033G22+ AAATCGCAAGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACAGC
                      ____________________________________________________________
consensus AAATCGCAAGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACAGC