Previous Contig 001496:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008C11Sequence483001496 (3)769020813gb:AY730335_16254074e-92Solanum tuberosum strain P6/210 clone BAC BA151m8, complete sequence.
JMFF015J18Sequence401001496 (3)612009766 (2)gb:AY730335_16254073e-86Solanum tuberosum strain P6/210 clone BAC BA151m8, complete sequence.
JMFF033G15Sequence517001496 (3)607009766 (2)gb:AY730335_16254073e-64Solanum tuberosum strain P6/210 clone BAC BA151m8, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF008C11+ CCAAATCCCCAGACCCTACCACCTCTTTGTTACTCCT
JMFF033G15+ CCAAATCCCCAGACCCTACCACCTCTTTGTTACTCCT
                      ____________________________________________________________
consensus CCAAATCCCCAGACCCTACCACCTCTTTGTTACTCCT
 
. : . : . : . : . : . :
JMFF015J18+ CTCAAACTCAGAT
JMFF008C11+ CCTTTTTGAATCATCACCCCCTAATCCCATATTTCACAAACCCTAAACTCAAACTCAGAT
JMFF033G15+ CCTTTTTGAATCATCACCCCCTAATCCCATATTTCACAAACCCTAAACTCAAACTCAGAT
                      ____________________________________________________________
consensus CCTTTTTGAATCATCACCCCCTAATCCCATATTTCACAAACCCTAAACTCAAACTCAGAT
 
. : . : . : . : . : . :
JMFF015J18+ ATCATCAAAATCCTCTAAAAACCCAAACCCCAATTCATCAACCCTTCAAGCCAAAACCCA
JMFF008C11+ NTCATCAAAATCCTCTAAAAACCCAAACCCCAATTCATCAACCCTTCAAGCCAAAACCCA
JMFF033G15+ ATCATCAAAATCCTCTAAAAACCCAAACCCCAATTCATCAACCCTTCAAGCCAAAACCCA
                      ____________________________________________________________
consensus ATCATCAAAATCCTCTAAAAACCCAAACCCCAATTCATCAACCCTTCAAGCCAAAACCCA
 
. : . : . : . : . : . :
JMFF015J18+ AAACTTTTTTTCAANTAGAATTTACTTTTCCTCCAAAATCAGGTCAAAAGCTGAATAACC
JMFF008C11+ AAACTTTTTTTCAACTAGAATTTACTTTTCCTCCAAAATCAGGTCAAAAGCTGAATAACC
JMFF033G15+ AAACTTTTTTTCAACTAGAATTTACTTTTCCTCCAAAATCAGGTCAAAAGCTGAATAACC
                      ____________________________________________________________
consensus AAACTTTTTTTCAACTAGAATTTACTTTTCCTCCAAAATCAGGTCAAAAGCTGAATAACC
 
. : . : . : . : . : . :
JMFF015J18+ CACTTTCAGAAAACCCTTGTATCACTCTCTCCCAAACAGAAAACTCACTTCTCTGTGAGA
JMFF008C11+ CACTTTCAGAAAACCCTTGTATCACTCTCTCCCAAACAGAAAACTCACTTCTCTGTGAGA
JMFF033G15+ CACTTTCAGAAAACCCTTGTATCACTCTCTCCCAAACAGAAAACTCACTTCTCTGTGAGA
                      ____________________________________________________________
consensus CACTTTCAGAAAACCCTTGTATCACTCTCTCCCAAACAGAAAACTCACTTCTCTGTGAGA
 
. : . : . : . : . : . :
JMFF015J18+ AATAGCTCAGACCCAGGCCTGGAAACGAAGGAAAACTGGCATTCGAAGTGTGGGTGGATT
JMFF008C11+ AATAGCTCAGACCCAGGCCTGGAAACGAAGGAAAACTGGCATTCGAAGTGTGGGTGGATT
JMFF033G15+ AATAGCTCAGACCCAGGCCTGGAAACGAAGGAAAACTGGCATTCGAAGTGTGGGTGGATT
                      ____________________________________________________________
consensus AATAGCTCAGACCCAGGCCTGGAAACGAAGGAAAACTGGCATTCGAAGTGTGGGTGGATT
 
. : . : . : . : . : . :
JMFF015J18+ CAGATCACGTGCCTTTGTGGAGTCTTGATTGACCTACCAACCTCTGAGAAGAAGAGGAGA
JMFF008C11+ CAGATCACGTGCCTTTGTGGAGTCTTGATTGACCTACCAACCTCTGAGAAGAAGAGGAGA
JMFF033G15+ CAGATCACGTGCCTTTGTGGAGTCTTGATTGACCTACCAACCTCTGAGAAGAAGAGGAGA
                      ____________________________________________________________
consensus CAGATCACGTGCCTTTGTGGAGTCTTGATTGACCTACCAACCTCTGAGAAGAAGAGGAGA
 
. : . : . : . : . : . :
JMFF015J18+ AGAGAAAAAGGAAGAGAACACAACACATCATACAAACAGTGAGTGCCAAGGCAAAGNTGG
JMFF008C11+ AGAGAAAAAGGAAGAGAACACAACACATCATACAAACAGTGAGTGCCAAGGCAAAGCTGG
JMFF033G15+ AGAGAAAAAGGAAGAGAACACAACACATCATACAAACAGTGAGTGCCAAGGCAAAGCTGG
                      ____________________________________________________________
consensus AGAGAAAAAGGAAGAGAACACAACACATCATACAAACAGTGAGTGCCAAGGCAAAGCTGG
 
. : . : . : . : . : . :
JMFF015J18+ TATCCCCCACTTCAAAAGTGCTCCCC
JMFF008C11+ TATCCCCCACTTCAAAAGTGCTCCCC
JMFF033G15+ TATCCCCCACTTCAAAAGTGCCCCCCAGAAAGAAAATGTCTGCTTCCCCCAAAGATAATT
                      ____________________________________________________________
consensus TATCCCCCACTTCAAAAGTGCTCCCCAGAAAGAAAATGTCTGCTTCCCCCAAAGATAATT