Previous Contig 001491:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033E03Sequence383001491 (2)
JMFF039O15Sequence411001491 (2)659021577gb:AF295664_17839632e-37Arabidopsis thaliana CBL-interacting protein kinase 9 (CIPK9) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF039O15+ CCCCAAAAAAAAAAGGTGGAAAAAACAAATCAGATCAACAAGTGCGTGCG
                      ____________________________________________________________
consensus CCCCAAAAAAAAAAGGTGGAAAAAACAAATCAGATCAACAAGTGCGTGCG
 
. : . : . : . : . : . :
JMFF039O15+ AAACAAGGACAAAAAGGAACGATGGAGAAACCGAAACGCGATATAGGACGGAAAGAAAAG
JMFF033E03+ GCGATATAGGCCGGAAAGAAAAG
                      ____________________________________________________________
consensus AAACAAGGACAAAAAGGAACGATGGAGAAACCGAAACGCGATATAGGCCGGAAAGAAAAG
 
. : . : . : . : . : . :
JMFF039O15+ GCAGAGGCCATAAATACAAGAAAAGAAAAGTAAGAATATTCCAAAA-ACTGATAAAAGAA
JMFF033E03+ GCNGAGGCCATAAATACAAGAAAAGAAAAGTAAGAATATTCCAAAANGCTGATANAAGAA
                      ____________________________________________________________
consensus GCAGAGGCCATAAATACAAGAAAAGAAAAGTAAGAATATTCCAAAANGCTGATAAAAGAA
 
. : . : . : . : . : . :
JMFF039O15+ GACTTCTACAAGATTCTTGAAAAATCAAATCGGCTGCAAATAAAACTCTTCCTTTTTTAC
JMFF033E03+ GACTTCTACAAGATTCTTGAAAAATCAAATCGGCTGCAAATAAAACTCTTCCTTTTTTAC
                      ____________________________________________________________
consensus GACTTCTACAAGATTCTTGAAAAATCAAATCGGCTGCAAATAAAACTCTTCCTTTTTTAC
 
. : . : . : . : . : . :
JMFF039O15+ ACGCTATATGAACTACGGAAAATTCAAAAAGGAAATGACTTATTTTTTCTGGAAAATGGG
JMFF033E03+ ACGCTATATGAACTACGGAAAATTCAAAAAGGAAATGACTTATTTTTTCTGGAAAATGGG
                      ____________________________________________________________
consensus ACGCTATATGAACTACGGAAAATTCAAAAAGGAAATGACTTATTTTTTCTGGAAAATGGG
 
. : . : . : . : . : . :
JMFF039O15+ TTATGGGTAAAAGTGTAAAACAAGGCCGAAAGCAGAATTCTTGATTGTTTATGATTAAAG
JMFF033E03+ TTATGGGTAAAAGTGTAAAACAAGGCCGAAAGCAGAATTCTTGATTGTTTATGATTAAAG
                      ____________________________________________________________
consensus TTATGGGTAAAAGTGTAAAACAAGGCCGAAAGCAGAATTCTTGATTGTTTATGATTAAAG
 
. : . : . : . : . : . :
JMFF039O15+ ACGATCGATGAAGGGGAAGAAGAATGAAGAATGAAGAATGAAGAATGAAGAATGAAGAAT
JMFF033E03+ ACGATCGATGAAGGGGAAGAAGAATGAAGAATGAAGAATGAAGAATGAAGAATGAAGAAT
                      ____________________________________________________________
consensus ACGATCGATGAAGGGGAAGAAGAATGAAGAATGAAGAATGAAGAATGAAGAATGAAGAAT
 
. : . : . : . : . : . :
JMFF039O15+ GT
JMFF033E03+ GTAATCAAACAGATGCCCGCTAAAGTGCTGAAATTTATATAGGAGGGGGATGGATTCTCG
                      ____________________________________________________________
consensus GTAATCAAACAGATGCCCGCTAAAGTGCTGAAATTTATATAGGAGGGGGATGGATTCTCG