Previous Contig 001490:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013I12Sequence596001490 (51)sp|P22180|PMA1_LYCES2e-60Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFF014C19Sequence347001490 (51)sp|P22180|PMA1_LYCES5e-37Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo608002519 (12)pir|T52412|T524122e-36H+-exporting ATPase (EC 3.6.3.6) plasma membrane isoform LHA2 [imported] - tomat
JMFF023C09Sequence432001490 (51)pir|T52414|T524147e-42H+-exporting ATPase (EC 3.6.3.6), plasma membrane [imported] - Prunus persica>gb633002519 (12)sp|Q08435|PMA1_NICPL4e-46Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A41779|A41779 H+-expo
JMFF033D18Sequence541001490 (51)sp|P22180|PMA1_LYCES2e-49Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo765002519 (12)gb:TOBPMA2A_17254968e-61Nicotiana plumbaginifolia plasma-membrane H+ ATPase (pma2), exons 13-21.
JMFF034O09Sequence511001490 (51)pir|T52414|T524144e-45H+-exporting ATPase (EC 3.6.3.6), plasma membrane [imported] - Prunus persica>gb713002519 (12)gb:TOBPMA2A_17254961e-51Nicotiana plumbaginifolia plasma-membrane H+ ATPase (pma2), exons 13-21.
JMFF035A14Sequence545001490 (51)sp|P22180|PMA1_LYCES4e-50Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo697002519 (12)gb:TOBPMA2A_17254965e-60Nicotiana plumbaginifolia plasma-membrane H+ ATPase (pma2), exons 13-21.
JMFF048I02Sequence465001490 (51)pir|T52414|T524141e-46H+-exporting ATPase (EC 3.6.3.6), plasma membrane [imported] - Prunus persica>gb378002519 (12)sp|Q08436|PMA3_NICPL1e-07Plasma membrane ATPase 3 (EC 3.6.3.6) (Proton pump 3).>gb:TOBPMA3A_1725498 Nicot
JMFS003C11Sequence577001490 (51)sp|P22180|PMA1_LYCES2e-60Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS010C01Sequence604001490 (51)sp|P22180|PMA1_LYCES2e-66Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS010C12Sequence625001490 (51)sp|P22180|PMA1_LYCES1e-70Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS010G10Sequence604001490 (51)sp|P22180|PMA1_LYCES1e-74Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS013D08Sequence641001490 (51)sp|P22180|PMA1_LYCES6e-79Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS022A10Sequence586001490 (51)sp|P22180|PMA1_LYCES6e-63Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS028D01Sequence620001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS028H05Sequence527001490 (51)sp|P22180|PMA1_LYCES5e-62Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS032D12Sequence613001490 (51)sp|P22180|PMA1_LYCES6e-67Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS040G11Sequence570001490 (51)sp|P22180|PMA1_LYCES9e-70Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS042F01Sequence602001490 (51)sp|P22180|PMA1_LYCES1e-69Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS044D12Sequence627001490 (51)sp|P22180|PMA1_LYCES4e-69Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS045B08Sequence631001490 (51)sp|P22180|PMA1_LYCES3e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS052F01Sequence483001490 (51)sp|Q08436|PMA3_NICPL7e-55Plasma membrane ATPase 3 (EC 3.6.3.6) (Proton pump 3).>gb:TOBPMA3A_1725498 Nicot
JMFS064B01Sequence621001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS064F04Sequence613001490 (51)sp|P22180|PMA1_LYCES6e-67Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS066G09Sequence631001490 (51)sp|P22180|PMA1_LYCES4e-70Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS067C07Sequence606001490 (51)sp|P22180|PMA1_LYCES3e-70Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS072A04Sequence631001490 (51)sp|P22180|PMA1_LYCES2e-72Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS074F04Sequence627001490 (51)sp|P22180|PMA1_LYCES1e-69Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS087E11Sequence612001490 (51)sp|P22180|PMA1_LYCES6e-67Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS092D04Sequence617001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS094D02Sequence616001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS096E06Sequence627001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS097H03Sequence620001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS098G06Sequence622001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS112C11Sequence611001490 (51)sp|P22180|PMA1_LYCES2e-67Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS117C03Sequence613001490 (51)sp|P22180|PMA1_LYCES2e-66Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS117E08Sequence623001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS124D03Sequence575001490 (51)sp|P22180|PMA1_LYCES7e-61Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS127C03Sequence626001490 (51)sp|P22180|PMA1_LYCES7e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS131C03Sequence611001490 (51)sp|P22180|PMA1_LYCES4e-53Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS132B02Sequence616001490 (51)sp|P22180|PMA1_LYCES1e-98Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS134C10Sequence619001490 (51)sp|P22180|PMA1_LYCES6e-67Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS136E02Sequence593001490 (51)sp|P22180|PMA1_LYCES9e-65Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS138G02Sequence588001490 (51)sp|P22180|PMA1_LYCES2e-61Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS141B07Sequence620001490 (51)sp|P22180|PMA1_LYCES1e-69Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS142A08Sequence621001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS151F05Sequence619001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS157A01Sequence661001490 (51)sp|Q08436|PMA3_NICPL3e-87Plasma membrane ATPase 3 (EC 3.6.3.6) (Proton pump 3).>gb:TOBPMA3A_1725498 Nicot
JMFS159A11Sequence438001490 (51)pir|T52414|T524149e-47H+-exporting ATPase (EC 3.6.3.6), plasma membrane [imported] - Prunus persica>gb
JMFS162C05Sequence556001490 (51)sp|P22180|PMA1_LYCES1e-61Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMFS168G04Sequence613001490 (51)sp|P22180|PMA1_LYCES2e-68Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo
JMSF041I05Sequence722001490 (51)sp|P22180|PMA1_LYCES5e-96Plasma membrane ATPase 1 (EC 3.6.3.6) (Proton pump 1).>pir|A45506|A45506 H+-expo579002519 (12)gb:TOBPMA2A_17254964e-37Nicotiana plumbaginifolia plasma-membrane H+ ATPase (pma2), exons 13-21.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I05+ TCGTAATAGCTCCCT
                      ____________________________________________________________
consensus TCGTAATAGCTCCCT
 
. : . : . : . : . : . :
JMFS132B02+ AGGACAGTTGGCATGGCAA
JMSF041I05+ GTTGAGCAAGACGATGGGAACCAATTGCCATTGTAACCGAGAGGACAGTTGGCATGGCAA
                      ____________________________________________________________
consensus GTTGAGCAAGACGATGGGAACCAATTGCCATTGTAACCGAGAGGACAGTTGGCATGGCAA
 
. : . : . : . : . : . :
JMFS132B02+ TCGGAATTCCACCGATAAGAAGTACAAGAAGATTGTCAATTCCAGGACGGTACTCCCGAT
JMSF041I05+ TCGGAATTCCACCGNTAAGAAGTACAAGAAGATNGTCAATTCCAGGACGGTACTCCCGAT
                      ____________________________________________________________
consensus TCGGAATTCCACCGATAAGAAGTACAAGAAGATTGTCAATTCCAGGACGGTACTCCCGAT
 
. : . : . : . : . : . :
JMFS028H05+ TAGGATACATGACAACGATCTCTATAACCATGCCCGCAGCGATAGAGCAAATGC
JMFS132B02+ GTTGAATAGGATACATGACAACGATCTCTATAACCATGCCCACAGCGATAGAGCAAATGC
JMSF041I05+ GTNGANTAGGATACATGACAACGATNTCTATAACCATGCCCACAGCGATAGAGCAAATGC
                      ____________________________________________________________
consensus GTTGAATAGGATACATGACAACGATCTCTATAACCATGCCCACAGCGATAGAGCAAATGC
 
. : . : . : . : . : . :
JMFS028H05+ AAGAGTTTGCAATTGCAGTCAGAGCCTTTTGGAAGTGACCGACTTGGTTAGTAGAGTCAG
JMFS132B02+ AAAAGTTTCCAATTGCAGTCAAAACCTTTTGGAAGTGACCGACTTGGTTAGTAGAGTCAA
JMSF041I05+ AAAAGTTTNCAATTGCAGTCAAAACCTTTTGGAAGTGACCGACTTGGTTAGTAGAGTCAA
                      ____________________________________________________________
consensus AAAAGTTTGCAATTGCAGTCAAAACCTTTTGGAAGTGACCGACTTGGTTAGTAGAGTCAA
 
. : . : . : . : . : . :
JMFS028H05+ CAAGGTGTGCAGCCTTTCCAAAGAAGGTATGAACCCCTGTGGCAATGACCACAGCTTCTA
JMFS132B02+ CAAGGTGTGCAGCCTTTCCAAAAAAGGTATGAACCCCTGTGGCAATGACCACAGCTTCTA
JMSF041I05+ CAAGGTGTGCAGCCTTTCCAAAAAAGGTATGAACCCCTGTGGCAATGACCACAGCTTNTA
JMFS157A01+ CCAAAAAAGGTATGAACCCCTGTGGCAATGACCACAGCTTCTA
                      ____________________________________________________________
consensus CAAGGTGTGCAGCCTTTCCAAAAAAGGTATGAACCCCTGTGGCAATGACCACAGCTTCTA
 
. : . : . : . : . : . :
JMFS028H05+ TCTACTCCCTGTTTACAAGTAGACCCAGAGTATATACCATCTCCAGGACCCTTAGTTACA
JMFS132B02+ TCT-CTCCCTGTTTACAAGTAGAACCAGAGTATATACCATCTCCAGGACCCTTAGTTACA
JMSF041I05+ TCT-CTCCCNGTTTACAAGTAGAACCAGAGTATATNCCATCTCCAGGACCCTTAGTTACA
JMFS157A01+ TCT-CTCCCTGTTTACAAGTAGAACCAGAGTATATACCATCTCCAGGACCCTTAGTTACA
JMFS013D08+ AACCAGAGTATATACCATCTCCAGGACCCTTAGTTACA
JMFS072A04+ AGTTACA
                      ____________________________________________________________
consensus TCT-CTCCCTGTTTACAAGTAGAACCAGAGTATATACCATCTCCAGGACCCTTAGTTACA
 
. : . : . : . : . : . :
JMFS028H05+ GGAAGAGATTCGCCGGTCAAAGCGGGCTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS132B02+ GGAAGAGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMSF041I05+ GGAAGAGATTCACCGGTCAAAGCGGANTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS157A01+ GGAAGAGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS013D08+ GGAAGAGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS072A04+ GGAAGAGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS010C12+ AAGAGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS074F04+ ATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS141B07+ GATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS067C07+ AGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS066G09+ AGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS042F01+ GATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS045B08+ AGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS117E08+ CCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS098G06+ CCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS142A08+ CGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS151F05+ CGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS168G04+ CGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS112C11+ AAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS136E02+ ATTTTCAATGGATCGCCATCAAGTAGA
JMFS022A10+ ATCGCCATCAAGTAGA
JMFS124D03+ AGTAGA
JMFS003C11+ CGCCATCAAGTAGA
JMFS162C05+ CCATCAAGTAGA
JMFF013I12+ GA
JMFS052F01+ ATCGCCATCAAGTAGA
JMFS010C01+ CTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS028D01+ CGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS097H03+ CCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS064F04+ CGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS064B01+ GGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS092D04+ CCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS094D02+ CGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS117C03+ GACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS010G10+ TTTCAATGGATCGCCATCAAGTAGA
JMFS044D12+ CACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS127C03+ GTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS134C10+ CGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS087E11+ CGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS040G11+ GTAGA
JMFS032D12+ CGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
JMFS138G02+ ATCAAGTAGA
JMFS096E06+ GGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
                      ____________________________________________________________
consensus GGAAGAGATTCACCGGTCAAAGCGGACTGATCAATTTTCAATGGATCGCCATCAAGTAGA
 
. : . : . : . : . : . :
JMFS028H05+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCCCCAGGTACCAAA
JMFS132B02+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMSF041I05+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACANTGATAATGTCACCAGGTACCAAA
JMFS157A01+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS013D08+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS072A04+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS010C12+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTAATAATGTCACCAGGTACCAAA
JMFS074F04+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS141B07+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS067C07+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS066G09+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS042F01+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS045B08+ CGAGCATTTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS117E08+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS098G06+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS142A08+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS151F05+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS168G04+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS112C11+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS136E02+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS022A10+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS124D03+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS003C11+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS162C05+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFF013I12+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS052F01+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS010C01+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS028D01+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS097H03+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS064F04+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS064B01+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS092D04+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS094D02+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS117C03+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS010G10+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS131C03+ CTGATAATGTCACCAGGTACCAAA
JMFS044D12+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS127C03+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS134C10+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS087E11+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS040G11+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCAGCAGGTACCAAA
JMFS032D12+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS138G02+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFS096E06+ CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
JMFF035A14+ GTACCAAA
JMFF033D18+ CAAA
                      ____________________________________________________________
consensus CGAGCATCTGCAGGAATTATATCTCCAAGTTTGACACTGATAATGTCACCAGGTACCAAA
 
. : . : . : . : . : . :
JMFS028H05+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGAGCCTTGGCCTTTGGAGCTAG
JMFS132B02+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMSF041I05+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS157A01+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS013D08+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS072A04+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS010C12+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS074F04+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS141B07+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS067C07+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS066G09+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS042F01+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS045B08+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTCTGGAGCGAG
JMFS117E08+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS098G06+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS142A08+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS151F05+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS168G04+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS112C11+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS136E02+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS022A10+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS124D03+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS003C11+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS162C05+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFF013I12+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS052F01+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS010C01+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS028D01+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS097H03+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS064F04+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS064B01+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS092D04+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS094D02+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS117C03+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS010G10+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTNGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS131C03+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS044D12+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS127C03+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS134C10+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS087E11+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS040G11+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCGGGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS032D12+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS138G02+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFS096E06+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFF035A14+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFF034O09+ TCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
JMFF033D18+ ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCCTGGCCTTTGGAGCGAG
                      ____________________________________________________________
consensus ATAGAAGCATCTTCCTCACTCCATCTTCCATCTCGAAGGA-CCTTGGCCTTTGGAGCGAG
 
. : . : . : . : . : . :
JMFS028H05+ TGCGAGCCATGAGACGCTGCTGCAGCATTACCCGCAGTGTTCTCCGCAATGAAACTGATA
JMFS132B02+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMSF041I05+ -GCGAGCCATGAGA-GCTGNTGCAGCATTACCCGCATTGTTCTCNTCAATGAAACTGATA
JMFS157A01+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS013D08+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS072A04+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS010C12+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS074F04+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS141B07+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS067C07+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS066G09+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS042F01+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS045B08+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS117E08+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS098G06+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS142A08+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS151F05+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS168G04+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS112C11+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS136E02+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS022A10+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS124D03+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS003C11+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS162C05+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFF013I12+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS052F01+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS010C01+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS028D01+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS097H03+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS064F04+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS064B01+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS092D04+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS094D02+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS117C03+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS010G10+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS131C03+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS044D12+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS127C03+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS134C10+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS087E11+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS040G11+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS032D12+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS138G02+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFS096E06+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFF035A14+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAGCTGATA
JMFF034O09+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFF048I02+ GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFF023C09+ AATGAAACTGATA
JMFS159A11+ GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
JMFF033D18+ -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
                      ____________________________________________________________
consensus -GCGAGCCATGAGA-GCTGCTGCAGCATTACCCGCATTGTTCTCCTCAATGAAACTGATA
 
. : . : . : . : . : . :
JMFS028H05+ GTGGAGTTTACGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGG
JMFS132B02+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMSF041I05+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS157A01+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS013D08+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS072A04+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS010C12+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS074F04+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS141B07+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS067C07+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS066G09+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS042F01+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS045B08+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS117E08+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS098G06+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS142A08+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS151F05+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS168G04+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS112C11+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS136E02+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS022A10+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS124D03+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS003C11+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS162C05+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFF013I12+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS052F01+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS010C01+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS028D01+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS097H03+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS064F04+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS064B01+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS092D04+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS094D02+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS117C03+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS010G10+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS131C03+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS044D12+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS127C03+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS134C10+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS087E11+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS040G11+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS032D12+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS138G02+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS096E06+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFF035A14+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFF034O09+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFF048I02+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFF023C09+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFS159A11+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
JMFF033D18+ GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
                      ____________________________________________________________
consensus GTGGAGTTTATGACAAGCAAAGTAATGATACCCACAAAGTCCTGCCAATCCGGGGGCTTT
 
. : . : . : . : . : . :
JMFS132B02+ C
JMSF041I05+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATA
JMFS157A01+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGAAG-TGCGTCAGGAACCCATGAGAGC
JMFS013D08+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS072A04+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS010C12+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS074F04+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS141B07+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS067C07+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS066G09+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS042F01+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS045B08+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS117E08+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS098G06+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS142A08+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS151F05+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS168G04+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS112C11+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS136E02+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS022A10+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS124D03+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS003C11+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS162C05+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFF013I12+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS052F01+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS010C01+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS028D01+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS097H03+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS064F04+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS064B01+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS092D04+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS094D02+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS117C03+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS010G10+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS131C03+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS044D12+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS127C03+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS134C10+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS087E11+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS040G11+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS032D12+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS138G02+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS096E06+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFF035A14+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFF034O09+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFF048I02+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFF023C09+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFS159A11+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
JMFF014C19+ GCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCANGAGAGC
JMFF033D18+ CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
                      ____________________________________________________________
consensus CCTCCTCCGTTTGCAAGAGCAATGGCCATTATGGCTGCAGCCTCCATAACCCATGAGAGC
 
. : . : . : . : . : . :
JMFS157A01+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS013D08+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS072A04+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS010C12+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS074F04+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS141B07+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS067C07+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS066G09+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS042F01+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS045B08+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS117E08+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS098G06+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS142A08+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS151F05+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS168G04+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS112C11+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS136E02+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS022A10+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS124D03+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS003C11+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS162C05+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFF013I12+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS052F01+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS010C01+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS028D01+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS097H03+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS064F04+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS064B01+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS092D04+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS094D02+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS117C03+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS010G10+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTGTTCTCCTCGAGCTTA
JMFS131C03+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS044D12+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS127C03+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS134C10+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS087E11+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS040G11+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCGTTCTTCTCCTCGAGCTTA
JMFS032D12+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS138G02+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS096E06+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFF035A14+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFF034O09+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFF048I02+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFF023C09+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFS159A11+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
JMFF014C19+ GGATTCCACATAACCCCCAAGAACTTCAGGANCTNGCTNTCCTTCTTCTCCTCGAGCTTA
JMFF033D18+ GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
                      ____________________________________________________________
consensus GGATTCCACATAAACCCCAAGAACTTCAGGAACTTGCTTTCCTTCTTCTCCTCGAGCTTA
 
. : . : . : . : . : . :
JMFS157A01+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS013D08+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS072A04+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS010C12+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS074F04+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS141B07+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS067C07+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS066G09+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS042F01+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS045B08+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS117E08+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS098G06+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS142A08+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS151F05+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS168G04+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS112C11+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS136E02+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS022A10+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS124D03+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS003C11+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS162C05+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFF013I12+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS052F01+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS010C01+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS028D01+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS097H03+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS064F04+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS064B01+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS092D04+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS094D02+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS117C03+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS010G10+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS131C03+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS044D12+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS127C03+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS134C10+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS087E11+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS040G11+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS032D12+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS138G02+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS096E06+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFF035A14+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFF034O09+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFF048I02+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGTCCATCTTTAGTG
JMFF023C09+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFS159A11+ TTATGCCCAAAAATGTCCAACCTCTCTTGGCCACCCTGACTAGTAAGGCCATCTTTAGTG
JMFF014C19+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
JMFF033D18+ TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
                      ____________________________________________________________
consensus TTATGCCCAAAAATGTCCAACCTCTCTTGGGCAGCCTGACTAGTAAGGCCATCTTTAGTG
 
. : . : . : . : . : . :
JMFS157A01+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS013D08+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS072A04+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS010C12+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS074F04+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS141B07+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS067C07+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS066G09+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS042F01+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS045B08+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS117E08+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS098G06+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS142A08+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS151F05+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS168G04+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS112C11+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS136E02+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS022A10+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS124D03+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS003C11+ CATCTCAGATTCTCCCCCCCTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS162C05+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFF013I12+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS052F01+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCAC
JMFS010C01+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS028D01+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS097H03+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS064F04+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS064B01+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS092D04+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS094D02+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS117C03+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS010G10+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS131C03+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS044D12+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS127C03+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS134C10+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS087E11+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS040G11+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS032D12+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS138G02+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS096E06+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFF035A14+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFF034O09+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFF048I02+ CATCTCGTATTCTTAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFF023C09+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFS159A11+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFF014C19+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
JMFF033D18+ CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
                      ____________________________________________________________
consensus CATCTCAGATTCTCAAACACTTCTTCAATGGGTATGTTTTCCAAATCCACAGTTTCCTTC
 
. : . : . : . : . : . :
JMFS157A01+ AACACAGCATCAAGAACTTCAGG
JMFS013D08+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS072A04+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS010C12+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS074F04+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS141B07+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS067C07+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS066G09+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS042F01+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS045B08+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS117E08+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS098G06+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS142A08+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS151F05+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS168G04+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS112C11+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS136E02+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS022A10+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS124D03+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS003C11+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS162C05+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFF013I12+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCAT
JMFS010C01+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS028D01+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS097H03+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS064F04+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATAACTCTCTCTCTCTCTCTTTCTCTC
JMFS064B01+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATAACTCTCTCTCTCTCTCTTTCTCTC
JMFS092D04+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS094D02+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS117C03+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS010G10+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS131C03+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCAT
JMFS044D12+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS127C03+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS134C10+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS087E11+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS040G11+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTGTCTCTCTCTTTCTCTC
JMFS032D12+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS138G02+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS096E06+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFF035A14+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFF034O09+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFF048I02+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFF023C09+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFS159A11+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFF014C19+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
JMFF033D18+ AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
                      ____________________________________________________________
consensus AACACAGCATCAAGAACTTCAGGCTTCTCAGCCATGACTCTCTCTCTCTCTCTTTCTCTC
 
. : . : . : . : . : . :
JMFS013D08+ TCAAGA
JMFS072A04+ TCAAGAAGGTTT-AGATCAGAAGAGCAA
JMFS010C12+ TCAAGAAGGTTTGAGATCAAAAGAGCAACC
JMFS074F04+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTT
JMFS141B07+ TCAAGAAGGTTTGAGATCAGAAGAGCAAC
JMFS067C07+ TCAAGAAGGTTTGA
JMFS066G09+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTA
JMFS042F01+ TCAAGAAGGTT
JMFS045B08+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTA
JMFS117E08+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTT
JMFS098G06+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTT
JMFS142A08+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTT
JMFS151F05+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATC
JMFS168G04+ TCAAGAAGGTTTGAGATCAGAAGAGCAAC
JMFS112C11+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAA
JMFS136E02+ TCAAGAAGGTTTGAGATCAGAAGAGCAAC
JMFS022A10+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAA
JMFS124D03+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTA
JMFS003C11+ TCAAGAAGGTTTGAGATCAGAAGAGC
JMFS162C05+ TCAAGAA
JMFS010C01+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAA
JMFS028D01+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCT
JMFS097H03+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATC
JMFS064F04+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTT
JMFS064B01+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTT
JMFS092D04+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTA
JMFS094D02+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTA
JMFS117C03+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAG
JMFS010G10+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTT
JMFS044D12+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAG
JMFS127C03+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTG
JMFS134C10+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTG
JMFS087E11+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTT
JMFS040G11+ TCAAGAAGGTTT-AGATCAGAAGAGCAAC
JMFS032D12+ TCAAGAAGGTTT-AGATCAGAAGAGCAACCTAATCTTTA
JMFS138G02+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGG
JMFS096E06+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTG
JMFF035A14+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTGCCCAGGAAAGAAGATT
JMFF034O09+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTCTAGGCTGCCCAGGAAAGAAGATT
JMFF048I02+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTGCCCAGGAAAGAAGATT
JMFF023C09+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTGCCCAGGAAAGAAGAT
JMFS159A11+ TCAACAAGGTTTGAGATCAGAAGAGCAACCTAA
JMFF014C19+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTGCCCAGGAAAGAAGAT
JMFF033D18+ TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTGCCCAGGAAAGAAGATT
                      ____________________________________________________________
consensus TCAAGAAGGTTTGAGATCAGAAGAGCAACCTAATCTTTAGGCTGCCCAGGAAAGAAGATT