Previous Contig 001482:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033B22Sequence436001482 (8)gb:AY248904_15926394e-05Nicotiana tabacum EIL2 mRNA, complete cds.683011024 (5)gb:AY248903_15926386e-19Nicotiana tabacum EIL1 mRNA, complete cds.
JMFF050M14Sequence550001482 (8)gb:AY248904_15926399e-13Nicotiana tabacum EIL2 mRNA, complete cds.590011024 (5)gb:AY248903_15926381e-10Nicotiana tabacum EIL1 mRNA, complete cds.
JMFS017F01Sequence591001482 (8)gb:AY248904_15926393e-24Nicotiana tabacum EIL2 mRNA, complete cds.
JMFS153A11Sequence618001482 (8)gb:AY248904_15926392e-30Nicotiana tabacum EIL2 mRNA, complete cds.
JMFS163B07Sequence584001482 (8)gb:AY248904_15926393e-24Nicotiana tabacum EIL2 mRNA, complete cds.
JMSF003B06Sequence261001482 (8)744011024 (5)gb:AB015855_15127301e-35Nicotiana tabacum mRNA for transcription factor TEIL, complete cds.
JMSF020I03Sequence650001482 (8)gb:AY248904_15926394e-37Nicotiana tabacum EIL2 mRNA, complete cds.759011024 (5)gb:AB015855_15127304e-37Nicotiana tabacum mRNA for transcription factor TEIL, complete cds.
JMSF028P15Sequence595001482 (8)gb:AY248904_15926393e-43Nicotiana tabacum EIL2 mRNA, complete cds.735011024 (5)gb:AB015855_15127301e-35Nicotiana tabacum mRNA for transcription factor TEIL, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028P15+ CAGCCGGGCCATTNNGATCAAACCTCACCTTATCCTTCCACC
                      ____________________________________________________________
consensus CAGCCGGGCCATTNNGATCAAACCTCACCTTATCCTTCCACC
 
. : . : . : . : . : . :
JMSF028P15+ ACTCCCTCAAATTATCAGACGCCCCGCTCACCGGCTTCCCTTTCTCCGGGATGATCCCGT
JMFS163B07+ ATGATCCCGT
JMFS153A11+ CGCCCCGCTCACGGGCTTCCCTTTCTNCGGGATGATCCCGT
JMFS017F01+ TGATCCCGT
JMSF020I03+ CCGCTCACCGGCTTCCCTTTCTCCGGGATGATCCCGT
                      ____________________________________________________________
consensus ACTCCCTCAAATTATCAGACGCCCCGCTCACCGGCTTCCCTTTCTCCGGGATGATCCCGT
 
. : . : . : . : . : . :
JMSF028P15+ AAACGAACCCNTGAGCCTTGCACACCTCCATCATCTTCAACATGTACTTCAAGATCCCGT
JMFS163B07+ AANCGAACCCCTGAGCCTTGCACACCTCCATCATCTTCAACATGTACTTCAAGATCCCGT
JMFS153A11+ AAACGAACCCCTGAGCCTTGCACACCTCCATCATCTTCAACATGTACTTCAAGATCCCGT
JMFS017F01+ AAACGAACCCNTGAGCCTTGCACACCTCCATCATCTTCAACATGTACTTCAAGATCCCGT
JMSF020I03+ AAACGAACCCCTGAGCCTTGCACACCTCCATCATCTTCAACATGTACTTCAAGATCCCGT
JMFF050M14+ AAGATCCCGT
                      ____________________________________________________________
consensus AAACGAACCCCTGAGCCTTGCACACCTCCATCATCTTCAACATGTACTTCAAGATCCCGT
 
. : . : . : . : . : . :
JMSF028P15+ CCTGAGCCCTCGACATCTTCTTCCTCCTCGCCTGCTCCTGAGACTTGTTCGTATCCCGTT
JMFS163B07+ CCTGAGCCCTCGACATCTTCTTCCTCCTCGCCTGCTCCTGAGACTTGTTCGTCTCCCGTT
JMFS153A11+ CCTGAGCCCTCGACATCTTCTTCCTCCTCGCCTGCTCCTGAGACTTGTTCGTCTCCCGTT
JMFS017F01+ CCTGAGCCCTCGACATCTTCTTCCTCCTCGCCTGCTCCTGAGACTTGTTCGTCTCCCGTT
JMSF020I03+ CCTGAGCCCTCGACATCTTCTTCCTCCTCGCCTGCTCCTGAGACTTGTTCGTCTCCCGTT
JMFF050M14+ CCTGAGCCCTCGACATCTTCTTCCTCCTCGCCTGCTCCTGAGACTTGTTCGTCTCCCGTT
                      ____________________________________________________________
consensus CCTGAGCCCTCGACATCTTCTTCCTCCTCGCCTGCTCCTGAGACTTGTTCGTCTCCCGTT
 
. : . : . : . : . : . :
JMSF028P15+ TAGCCCCATCCTCGCCCTCGCCCTCCTTACTCTTGCTCATCTCCTTCAAACGTTTCAGCT
JMFS163B07+ TAGCCCCATCCTCGCCCTCGCCCTCCTTACTCTTGCTCATCTCCTTCAAACGTTTCAGCT
JMFS153A11+ TAGCCCCATCCTCGCCCTCGCCCTCCTTACTCTTGCTCATCTCCTTCAAACGTTTCAGCT
JMFS017F01+ TAGCCCCATCCTCGCCCTCGCCCTCCTTACTCTTGCTCATCTCCTTCAAACGTTTCAGCT
JMSF020I03+ TAGCCCCATCCTCGCCCTCGCCCTCCTTACTCTTGCTCATCTCCTTCAAACGTTTCAGCT
JMFF050M14+ TAGCCCCATCCTCGCCCTCGCCCTCCTTACTCTTGCTCATCTCCTTCAAACGTTTCAGCT
JMFF033B22+ CTTCAAACGTTTCAGNT
                      ____________________________________________________________
consensus TAGCCCCATCCTCGCCCTCGCCCTCCTTACTCTTGCTCATCTCCTTCAAACGTTTCAGCT
 
. : . : . : . : . : . :
JMSF028P15+ TCATCTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
JMFS163B07+ TCATCTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
JMFS153A11+ TCATCTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
JMFS017F01+ TCATCTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
JMSF020I03+ TCATCTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
JMFF050M14+ TCATCTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
JMFF033B22+ TCATNTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
                      ____________________________________________________________
consensus TCATCTTGTCCCTCCACATCCTCCTCTCCAGCTCCTCCATATCCATTTCATCGTCGCTAT
 
. : . : . : . : . : . :
JMSF028P15+ AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
JMFS163B07+ AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
JMFS153A11+ AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
JMFS017F01+ AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
JMSF020I03+ AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
JMFF050M14+ AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
JMFF033B22+ AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
                      ____________________________________________________________
consensus AGTCATCCTCCACCTCCACCACCACCGCCGCCTCGGGCTCAGCCCCGGGCGGTGGAGCAA
 
. : . : . : . : . : . :
JMSF028P15+ CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
JMFS163B07+ CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
JMFS153A11+ CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
JMFS017F01+ CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
JMSF020I03+ CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
JMFF050M14+ CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
JMSF003B06+ GAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
JMFF033B22+ CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
                      ____________________________________________________________
consensus CCATATCAGCTGGCTCTTTCAGAGGAGCCAGGAAGGAATCAAGATCATTACAGAACCCCA
 
. : . : . : . : . : . :
JMSF028P15+ TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
JMFS163B07+ TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
JMFS153A11+ TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
JMFS017F01+ TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
JMSF020I03+ TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
JMFF050M14+ TATCATCAAACATCATCATCTTCAATCCNCAGCCACCTCTAAATCCAAGAACACAATTGG
JMSF003B06+ TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
JMFF033B22+ TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
                      ____________________________________________________________
consensus TATCATCAAACATCATCATCTTCAATCC-CAGCAGCCTCTAAATCCAAGAACACAATTGG
 
. : . : . : . : . : . :
JMSF028P15+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
JMFS163B07+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
JMFS153A11+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
JMFS017F01+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
JMSF020I03+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
JMFF050M14+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
JMSF003B06+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
JMFF033B22+ GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
                      ____________________________________________________________
consensus GAATTTGGGATTCAACAACCAAACCTGCAAATTCAGTGCCTCAGAGGTTTCTGGGTTTTT
 
. : . : . : . : . : . :
JMSF028P15+ TCTCTCTTCCAAC
JMFS163B07+ TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
JMFS153A11+ TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
JMFS017F01+ TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
JMSF020I03+ TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
JMFF050M14+ TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
JMSF003B06+ TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
JMFF033B22+ TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
                      ____________________________________________________________
consensus TCTCTCTTCCAACAGTCTGTTCAACTCTTCTCTCCTTGAGAATAATTGACTCTCTAGACT
 
. : . : . : . : . : . :
JMFS163B07+ TCAGAGGATAGAGAGAGAAAAGTACACACACGAAA
JMFS153A11+ TCAGAGGATAGAGAGAGAAAAGTACACACACGAAAGAA
JMFS017F01+ TCAGAGGATAGAGAGAGAAAAGTACACACACGAAAGAAGGTTC
JMSF020I03+ TCAGAGGATAGAGAGAGAAAAGTACACACACGAAAGAAGGTTC
JMFF050M14+ TCAGAGGATAGAGAGAGAAAAGTACACACACGAAAGAAGGTTCAGAGAAATGGAAGTTAC
JMSF003B06+ TCAGAGGATAGAGAGAGAAAAGTACACACACGAAAGAAGGTTCAG
JMFF033B22+ TCAGAGGATAGAGAGAGAAAAGTACACACACGAAAGAAGGTTCAGAGAAATGGAAGTTAC
                      ____________________________________________________________
consensus TCAGAGGATAGAGAGAGAAAAGTACACACACGAAAGAAGGTTCAGAGAAATGGAAGTTAC