Previous Contig 001475:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003K18Sequence585001475 (10)gb:AY083163_15692262e-76Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.658009739 (14)gb:AF525534_18083128e-73Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMFF006H09Sequence513001475 (10)gb:AY083163_15692264e-62Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.758009739 (14)gb:AF525534_18083122e-86Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMFF010D22Sequence585001475 (10)gb:AY083163_15692261e-78Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.766009739 (14)gb:AF525534_18083122e-85Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMFF015C17Sequence538001475 (10)gb:AY083163_15692263e-70Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.745009739 (14)gb:AF525534_18083124e-86Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMFF018E16Sequence588001475 (10)gb:AY083163_15692262e-79Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.734009739 (14)gb:AF525534_18083123e-84Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMFF022C05Sequence535001475 (10)gb:AY083163_15692262e-69Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.750009739 (14)gb:AF525534_18083124e-87Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMFF028N22Sequence549001475 (10)gb:AY083163_15692261e-71Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.735009739 (14)gb:AF525534_18083123e-84Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMFF032N13Sequence601001475 (10)gb:AY083163_15692261e-63Olea europaea subsp. europaea fatty acid desaturase 2 (fad2) mRNA, complete cds.699009739 (14)gb:AY660024_16203005e-67Nicotiana tabacum microsomal omega-6-desaturase (FAD2) mRNA, complete cds; nucle
JMFF037I15Sequence527001475 (10)gb:AF243045_17802082e-63Brassica napus delta-12 oleate desaturase mRNA, complete cds.748009739 (14)gb:AF525534_18083122e-86Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.
JMSF024B05Sequence707001475 (10)gb:AF074324_17660995e-98Borago officinalis delta-12 fatty acid desaturase mRNA, complete cds.735009739 (14)gb:AF525534_18083123e-87Vernicia fordii delta 12 oleic acid desaturase FAD2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024B05+ GCCCAGAAACATTGAACATC
                      ____________________________________________________________
consensus GCCCAGAAACATTGAACATC
 
. : . : . : . : . : . :
JMSF024B05+ AGGTATAGAGGCCACCCTAGAGTGAGCTGGACAAGGAGCGTGAATGCTCTGCCAGGGGGG
                      ____________________________________________________________
consensus AGGTATAGAGGCCACCCTAGAGTGAGCTGGACAAGGAGCGTGAATGCTCTGCCAGGGGGG
 
. : . : . : . : . : . :
JMFF010D22+ GTACAAAGACTTCA
JMFF003K18+ GTACAAAGACTTCA
JMFF018E16+ GTACAAAGACTTCA
JMSF024B05+ TTGTTAAGATATTTGGCATGCGATTTCATGCCAGATTTCTTCTTAGGTACAAAGACTTCA
                      ____________________________________________________________
consensus TTGTTAAGATATTTGGCATGCGATTTCATGCCAGATTTCTTCTTAGGTACAAAGACTTCA
 
. : . : . : . : . : . :
JMFF028N22+ TTGAATGGTGACGGCGATGGCTATATTTCCAAGAGAAG
JMFF010D22+ TCCCGTTCAAGGGAACCAGTGTTTGAATGGTGACGGCGATGGCTATATTTCCAAGAGAAG
JMFF003K18+ TCCCGTTCAAGGGAACCAGTGTTTGAATGGTGACGGCGATGGCTATATTTCCAAGAGAAG
JMFF018E16+ TCCCGTTCAAGGGAACCAGTGTTTGAATGGTGACGGCGATGGCTATATTTCCAAGAGAAG
JMFF037I15+ GCGATGGCTATATTTCCAAGAGAAG
JMFF022C05+ GACGGCGATGGCTATATTTCCAAGAGAAG
JMFF015C17+ GGTGACGGCGATGGCTATATTTCCAAGAGAAG
JMFF006H09+ AGAGAAG
JMSF024B05+ TCCCGTTCAAGGGAACCAGTGTTTGAATGGTGACGGCGATGGCTATATTTCCAAGAGAAG
JMFF032N13+ GAGAAG
                      ____________________________________________________________
consensus TCCCGTTCAAGGGAACCAGTGTTTGAATGGTGACGGCGATGGCTATATTTCCAAGAGAAG
 
. : . : . : . : . : . :
JMFF028N22+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF010D22+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF003K18+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF018E16+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF037I15+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF022C05+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF015C17+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF006H09+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMSF024B05+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
JMFF032N13+ TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
                      ____________________________________________________________
consensus TATGGAACAAGGAGAGCAGAGTGTAGGATAAGTCCAACAGTGTCATCAAGCCATTGGTAG
 
. : . : . : . : . : . :
JMFF028N22+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMFF010D22+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMFF003K18+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCAAAACTCCGGTGAGTACACAG
JMFF018E16+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMFF037I15+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMFF022C05+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMFF015C17+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMFF006H09+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMSF024B05+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
JMFF032N13+ TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
                      ____________________________________________________________
consensus TCACTGAATGCATGATGGCCACATTCATGAGCAATGACCCAAACTCCGGTGAGTACACAG
 
. : . : . : . : . : . :
JMFF028N22+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF010D22+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF003K18+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF018E16+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF037I15+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF022C05+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF015C17+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF006H09+ CCNTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMSF024B05+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
JMFF032N13+ CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
                      ____________________________________________________________
consensus CCTTGGCAGATCCAGTAAAGTGGCCAGGCCAGGTAAGAGAGAGGGTGTGGGAGGAGATGG
 
. : . : . : . : . : . :
JMFF028N22+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMFF010D22+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMFF003K18+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMFF018E16+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMFF037I15+ AAATAGCTTGTTGCAACATAGTAGAG----GAAGCAATTATGAGGTCATAAACAACATAG
JMFF022C05+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMFF015C17+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMFF006H09+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMSF024B05+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
JMFF032N13+ AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
                      ____________________________________________________________
consensus AAATAGCTTGTTGCAACATAGTAGAGGAGAGAAGCAATTATGAGGTCATAAACAACATAG
 
. : . : . : . : . : . :
JMFF028N22+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF010D22+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF003K18+ AAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF018E16+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF037I15+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF022C05+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF015C17+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF006H09+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTNTTAATCTCA
JMSF024B05+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
JMFF032N13+ GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
                      ____________________________________________________________
consensus GAGAATGAGCGAAGAACGGATCGTTGAAAACAATGGGGTGGGATGGCTTTCTTAATCTCA
 
. : . : . : . : . : . :
JMFF028N22+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF010D22+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF003K18+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF018E16+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF037I15+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF022C05+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF015C17+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF006H09+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTN
JMSF024B05+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
JMFF032N13+ CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
                      ____________________________________________________________
consensus CCAACTGTGAAAGGTGGTTTGGCATATGGAACACGCTTAACAACATCAGATTTGGACTTC
 
. : . : . : . : . : . :
JMFF028N22+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTTACTGAACTGAACGA
JMFF010D22+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTTACTGAACTGAACGA
JMFF003K18+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTTACTGAACTGAACGA
JMFF018E16+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTTACTGAACTGAACGA
JMFF037I15+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTT-----ACTGAACGA
JMFF022C05+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTT-----ACTGAACGA
JMFF015C17+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTT-----ACTGAACGA
JMFF006H09+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTT-----ACTGAACGA
JMSF024B05+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTT-----ACTGAACGA
JMFF032N13+ TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTT-----ACTGAACGA
                      ____________________________________________________________
consensus TTGCCCTCAGGCTGTACAGCCGTCCTGCCTCCAGCACCCATTGTTT-----ACTGAACGA
 
. : . : . : . : . : . :
JMFF028N22+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF010D22+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF003K18+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF018E16+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF037I15+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF022C05+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF015C17+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF006H09+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMSF024B05+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
JMFF032N13+ CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
                      ____________________________________________________________
consensus CCTTCCGTTCCTCTTTCTCAACCTCCAAGAGCTCTTCTCTCTCTCCCTCTCTCTCTCTCC
 
. : . : . : . : . : . :
JMFF028N22+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMFF010D22+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMFF003K18+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMFF018E16+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMFF037I15+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMFF022C05+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMFF015C17+ CTATATGTGAATCTCCGGCGGCCTTGAATCT
JMFF006H09+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMSF024B05+ CTATATGTGAATCTCCGGCGGCCTTGTATCT
JMFF032N13+ CTATATGTGAATCTCCGGCGGCCTTGTATCTGCGTATGAGGAGAAGAGAGGCCGGTATTT
                      ____________________________________________________________
consensus CTATATGTGAATCTCCGGCGGCCTTGTATCTGCGTATGAGGAGAAGAGAGGCCGGTATTT
 
. : . : . : . : . : . :
JMFF032N13+ AAGCTTTGGGCTTCCCTCCGAATTCCGAAACGGAAGCACCCTCGTCTATACGTACACCGT
                      ____________________________________________________________
consensus AAGCTTTGGGCTTCCCTCCGAATTCCGAAACGGAAGCACCCTCGTCTATACGTACACCGT