Previous Contig 001469:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032J15Sequence579001469 (3)774009725 (2)gb:AK175797_18177857e-17Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-
JMFF038E15Sequence453001469 (3)379009725 (2)gb:AC108523_17385734e-05Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_C04, complete s
JMFS044F02Sequence602001469 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS044F02+ GTTAATTCCTCAGCATTATCAGCTCCC
                      ____________________________________________________________
consensus GTTAATTCCTCAGCATTATCAGCTCCC
 
. : . : . : . : . : . :
JMFS044F02+ TCTTTTCTCGCGACTTCTTCCTCCAAGTCTTGTTTTTTATGATCATGTTCATTGAACAAT
JMFF032J15+ TCCAAGTCTTGTTTTTTATGATCATGTTCATTGAACAAT
                      ____________________________________________________________
consensus TCTTTTCTCGCGACTTCTTCCTCCAAGTCTTGTTTTTTATGATCATGTTCATTGAACAAT
 
. : . : . : . : . : . :
JMFS044F02+ TTGGCTGCTGCTTCTGCAATTCCTGCTTCAGCAGTGCCCTTTCCGCTATCTTCTCCATTG
JMFF032J15+ TTGGCTGCTGCTTCTGCAATTCCTGCTTCAGCAGTGCCCTTTCCGCTATCTTCTCCATTG
                      ____________________________________________________________
consensus TTGGCTGCTGCTTCTGCAATTCCTGCTTCAGCAGTGCCCTTTCCGCTATCTTCTCCATTG
 
. : . : . : . : . : . :
JMFS044F02+ GATGGGGCTAATTCTTGGTCACTATCTGCTCCCGCTTCTTCTACATCTTCCTTTTCCCCC
JMFF038E15+ GCTCCCGCTTCTTCTACATCTTCCTTTTCCCCC
JMFF032J15+ GATGGGGCTAATTCTTGGTCACTATCTGCTCCCGCTTCTTCTACATCTTCCTTTTCCCCC
                      ____________________________________________________________
consensus GATGGGGCTAATTCTTGGTCACTATCTGCTCCCGCTTCTTCTACATCTTCCTTTTCCCCC
 
. : . : . : . : . : . :
JMFS044F02+ TCCTCCTCTTCTTCTTCTACTTCTTCCACTTCTTCTTCCTCTTCAACCTCAATTTCTTCC
JMFF038E15+ TCCTCCTCTTCTTCTTNTACTTCTTCCACTTCTTCTTCCTCTTCAACCTCAATTTCTTCC
JMFF032J15+ TCCTCCTCTTCTTCTTCTACTCCTTCCACTTCTTCTTCCTCTTCAACCTCAATTTCTTCC
                      ____________________________________________________________
consensus TCCTCCTCTTCTTCTTCTACTTCTTCCACTTCTTCTTCCTCTTCAACCTCAATTTCTTCC
 
. : . : . : . : . : . :
JMFS044F02+ TCTATTTCTTCTTCTATCTCCTCGTACTCGTACTCGTACTCCTCATCCTCCATCTCCTGT
JMFF038E15+ TCTATTTCTTCTTCTATCTCCTCGTACTCGTACTCGTACTCCTCATCCTCCATCTCCTGT
JMFF032J15+ TCTATTTCTTCTTCTATCTCCTCGTACTCGTACTCGTAATCTTCATCCTCCATCTCCTGT
                      ____________________________________________________________
consensus TCTATTTCTTCTTCTATCTCCTCGTACTCGTACTCGTACTCCTCATCCTCCATCTCCTGT
 
. : . : . : . : . : . :
JMFS044F02+ TCGGACTTGGAGGCAGGGTCCACGGTGTTGTGTGGTGGATCAACCGCCGCCGCAGCGGAG
JMFF038E15+ TCGGACTTGGAGGCAGGGTCCACGGTGTTGTGTGGTGGATCAACCGCCGCCGCAGCGGAG
JMFF032J15+ TCGGACTTGGAGGCAGGGTCCACGGTGTTGTGTGGTGGATCAACCGCCGCCGCAGCGGAG
                      ____________________________________________________________
consensus TCGGACTTGGAGGCAGGGTCCACGGTGTTGTGTGGTGGATCAACCGCCGCCGCAGCGGAG
 
. : . : . : . : . : . :
JMFS044F02+ GACATCGCATGCAGCGGTGGCGTAGCTCCGATGAAGAGGTGATGTGGAGTTGATTAGGGT
JMFF038E15+ GACATCGCATGCAGCGGTGGCGTAGCTCCGATGAAGAGGTGATGTGGAGTTGATTAGGGT
JMFF032J15+ GACATCGCATGCAGCGGTGGCGTAGCTCCGATGAAGAGGTGATGTGGAGTTGATTAGGGT
                      ____________________________________________________________
consensus GACATCGCATGCAGCGGTGGCGTAGCTCCGATGAAGAGGTGATGTGGAGTTGATTAGGGT
 
. : . : . : . : . : . :
JMFS044F02+ TAGGGTTCCGTATACCGTAACACAGACCTCACCGTCTGAAAAGTGACATGCATTTGACGG
JMFF038E15+ TAGGGTTCCGTATACCGTAACACAGACCTCACCGTCTGAAAAGTGACATGCATTTGACGG
JMFF032J15+ TAGGGTTCCGTATACCGTAACACAGACCTCACCGTCTGAAAAGTGACATGCATTTGACGG
                      ____________________________________________________________
consensus TAGGGTTCCGTATACCGTAACACAGACCTCACCGTCTGAAAAGTGACATGCATTTGACGG
 
. : . : . : . : . : . :
JMFS044F02+ CGACGAAAAACCAGTAAACCGCCGACAACAATGGCTGAAACGCTAGAGAATACAGAACTA
JMFF038E15+ CGACGAAAAACCAGTAAACCGCCGACAACAATGGCTGAAACGCTAGAGAATACAGAACTA
JMFF032J15+ CGACGAAAAACCAGTAAACCGCCGACAACAATGGCTGAAACGCTAGAGAATACAGAACTA
                      ____________________________________________________________
consensus CGACGAAAAACCAGTAAACCGCCGACAACAATGGCTGAAACGCTAGAGAATACAGAACTA
 
. : . : . : . : . : . :
JMFS044F02+ TAATCCCCCTCTGGATTCTGATTTGGGGATCACAA
JMFF038E15+ TAATCCCCCTCTGGATTCTGATTTGGGGATCACAATTTCATTCTTGTATGGATTGAT
JMFF032J15+ TAATCCCCCTCTGGATTCTGATTTGGGGATCACAATTTCATTCTTGTATGGATTGATACT
                      ____________________________________________________________
consensus TAATCCCCCTCTGGATTCTGATTTGGGGATCACAATTTCATTCTTGTATGGATTGATACT